Incidental Mutation 'R5870:Zfr'
ID455153
Institutional Source Beutler Lab
Gene Symbol Zfr
Ensembl Gene ENSMUSG00000022201
Gene Namezinc finger RNA binding protein
Synonyms
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location12117831-12185683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12160615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 758 (V758D)
Ref Sequence ENSEMBL: ENSMUSP00000118911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122941]
Predicted Effect probably damaging
Transcript: ENSMUST00000122941
AA Change: V758D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: V758D

DomainStartEndE-ValueType
low complexity region 69 116 N/A INTRINSIC
low complexity region 159 182 N/A INTRINSIC
low complexity region 196 224 N/A INTRINSIC
low complexity region 229 302 N/A INTRINSIC
ZnF_U1 328 362 7.79e-6 SMART
ZnF_C2H2 331 355 4.94e0 SMART
ZnF_U1 379 413 1.84e-7 SMART
ZnF_C2H2 382 406 4.65e-1 SMART
low complexity region 429 448 N/A INTRINSIC
low complexity region 468 483 N/A INTRINSIC
ZnF_U1 579 613 2.01e-8 SMART
ZnF_C2H2 582 606 1.31e0 SMART
low complexity region 630 664 N/A INTRINSIC
low complexity region 685 719 N/A INTRINSIC
low complexity region 766 782 N/A INTRINSIC
DZF 784 1038 5.42e-170 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155054
AA Change: V91D
SMART Domains Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201
AA Change: V91D

DomainStartEndE-ValueType
low complexity region 19 53 N/A INTRINSIC
PDB:4ATB|D 56 94 6e-11 PDB
low complexity region 100 114 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156752
AA Change: V25D
SMART Domains Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201
AA Change: V25D

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
DZF 57 299 1.79e-152 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158625
Meta Mutation Damage Score 0.7885 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Zfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Zfr APN 15 12159646 missense probably benign 0.26
IGL01759:Zfr APN 15 12159655 missense probably damaging 0.99
IGL01935:Zfr APN 15 12180712 missense probably benign 0.42
IGL02056:Zfr APN 15 12154447 missense probably damaging 1.00
IGL03009:Zfr APN 15 12162235 missense probably damaging 1.00
IGL03147:Zfr UTSW 15 12140552 nonsense probably null
PIT4504001:Zfr UTSW 15 12166158 missense possibly damaging 0.48
R0377:Zfr UTSW 15 12160591 missense probably benign 0.02
R0678:Zfr UTSW 15 12184085 missense probably damaging 1.00
R0783:Zfr UTSW 15 12162182 missense probably damaging 1.00
R0787:Zfr UTSW 15 12140548 missense unknown
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1538:Zfr UTSW 15 12150243 missense possibly damaging 0.61
R1558:Zfr UTSW 15 12140644 missense unknown
R1619:Zfr UTSW 15 12150387 missense possibly damaging 0.52
R1924:Zfr UTSW 15 12160629 missense possibly damaging 0.74
R2163:Zfr UTSW 15 12162223 missense probably damaging 1.00
R2958:Zfr UTSW 15 12162233 missense probably benign 0.08
R2960:Zfr UTSW 15 12162233 missense probably benign 0.08
R2961:Zfr UTSW 15 12162233 missense probably benign 0.08
R2962:Zfr UTSW 15 12162233 missense probably benign 0.08
R2963:Zfr UTSW 15 12162233 missense probably benign 0.08
R3012:Zfr UTSW 15 12166163 missense probably damaging 1.00
R3054:Zfr UTSW 15 12154507 missense probably damaging 1.00
R3429:Zfr UTSW 15 12152920 missense probably benign 0.00
R3611:Zfr UTSW 15 12159762 critical splice donor site probably null
R3825:Zfr UTSW 15 12166191 missense probably damaging 1.00
R3882:Zfr UTSW 15 12162233 missense probably benign 0.08
R4080:Zfr UTSW 15 12162233 missense probably benign 0.08
R4241:Zfr UTSW 15 12149659 missense probably damaging 1.00
R4366:Zfr UTSW 15 12156330 missense probably damaging 0.99
R4375:Zfr UTSW 15 12118340 critical splice donor site probably null
R4893:Zfr UTSW 15 12136542 missense unknown
R4899:Zfr UTSW 15 12166145 missense probably benign 0.11
R4915:Zfr UTSW 15 12162112 critical splice acceptor site probably null
R6162:Zfr UTSW 15 12146245 missense unknown
R6163:Zfr UTSW 15 12146245 missense unknown
R6165:Zfr UTSW 15 12146245 missense unknown
R6187:Zfr UTSW 15 12146231 small deletion probably benign
R6251:Zfr UTSW 15 12160591 missense probably benign 0.02
R6903:Zfr UTSW 15 12136455 missense unknown
R6959:Zfr UTSW 15 12150323 missense probably damaging 1.00
R7133:Zfr UTSW 15 12180638 missense probably damaging 1.00
R7167:Zfr UTSW 15 12180929 missense probably benign 0.01
R7212:Zfr UTSW 15 12146223 nonsense probably null
R7373:Zfr UTSW 15 12140559 missense unknown
R7489:Zfr UTSW 15 12152982 missense probably benign 0.24
R7602:Zfr UTSW 15 12159677 missense possibly damaging 0.56
R7623:Zfr UTSW 15 12160528 missense possibly damaging 0.83
R7896:Zfr UTSW 15 12146377 missense probably damaging 1.00
R8188:Zfr UTSW 15 12171818 missense probably damaging 1.00
R8289:Zfr UTSW 15 12135271 missense noncoding transcript
R8382:Zfr UTSW 15 12152968 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACAGTTTGCTTAATTGCCTTTC -3'
(R):5'- TGTGGACTAACACCAATTTCCC -3'

Sequencing Primer
(F):5'- GCCTTTCTTACTTTAAAGCTAGCAAC -3'
(R):5'- TGCCAGGTGAGTTCAGATACC -3'
Posted On2017-02-10