Incidental Mutation 'R5870:Esco1'
ID 455161
Institutional Source Beutler Lab
Gene Symbol Esco1
Ensembl Gene ENSMUSG00000024293
Gene Name establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms A930014I12Rik
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R5870 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 10566602-10610352 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 10593744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025142] [ENSMUST00000097670] [ENSMUST00000115864]
AlphaFold Q69Z69
Predicted Effect probably null
Transcript: ENSMUST00000025142
SMART Domains Protein: ENSMUSP00000025142
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
coiled coil region 8 32 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Pfam:zf-C2H2_3 607 646 4.7e-17 PFAM
Pfam:Acetyltransf_13 766 834 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097670
SMART Domains Protein: ENSMUSP00000095274
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 108 148 1.7e-19 PFAM
Pfam:Acetyltransf_13 266 335 4.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115864
SMART Domains Protein: ENSMUSP00000111530
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 83 123 1.8e-19 PFAM
Pfam:Acetyltransf_13 241 310 4.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145320
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESCO1 belongs to a conserved family of acetyltransferases involved in sister chromatid cohesion (Hou and Zou, 2005 [PubMed 15958495]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Esco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Esco1 APN 18 10582078 missense probably damaging 1.00
IGL01376:Esco1 APN 18 10594892 nonsense probably null
IGL01886:Esco1 APN 18 10595262 missense probably damaging 1.00
IGL03171:Esco1 APN 18 10594263 missense probably damaging 1.00
IGL03233:Esco1 APN 18 10574877 missense probably damaging 1.00
PIT4576001:Esco1 UTSW 18 10572093 missense probably damaging 1.00
PIT4585001:Esco1 UTSW 18 10594355 nonsense probably null
R0266:Esco1 UTSW 18 10594605 missense probably benign 0.00
R0445:Esco1 UTSW 18 10574989 missense probably damaging 1.00
R0494:Esco1 UTSW 18 10594940 missense probably benign 0.28
R0965:Esco1 UTSW 18 10567570 missense probably damaging 1.00
R1834:Esco1 UTSW 18 10594350 missense probably damaging 1.00
R2140:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2141:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2142:Esco1 UTSW 18 10574873 critical splice donor site probably null
R4562:Esco1 UTSW 18 10595074 missense possibly damaging 0.74
R4668:Esco1 UTSW 18 10594734 missense possibly damaging 0.60
R5083:Esco1 UTSW 18 10594734 missense probably benign 0.00
R5128:Esco1 UTSW 18 10567468 utr 3 prime probably benign
R5407:Esco1 UTSW 18 10574886 missense probably damaging 1.00
R5454:Esco1 UTSW 18 10584327 missense probably benign
R5965:Esco1 UTSW 18 10593867 missense possibly damaging 0.94
R6360:Esco1 UTSW 18 10574931 missense probably damaging 1.00
R6390:Esco1 UTSW 18 10567528 missense probably damaging 1.00
R6438:Esco1 UTSW 18 10572031 missense probably damaging 1.00
R6524:Esco1 UTSW 18 10582188 critical splice acceptor site probably null
R6534:Esco1 UTSW 18 10594794 missense possibly damaging 0.90
R6633:Esco1 UTSW 18 10595738 intron probably benign
R8743:Esco1 UTSW 18 10572123 missense probably damaging 1.00
R8877:Esco1 UTSW 18 10575017 missense probably damaging 1.00
R9065:Esco1 UTSW 18 10594005 missense probably benign 0.00
R9141:Esco1 UTSW 18 10594731 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGCTAGCATTTCAGTTATAGTTTCC -3'
(R):5'- ACTTGCCAACGGGATAAAATG -3'

Sequencing Primer
(F):5'- AATGGTAAAAACAAGGAAAACAAGG -3'
(R):5'- CTTGCCAACGGGATAAAATGAAAGG -3'
Posted On 2017-02-10