Incidental Mutation 'R5870:Ctdp1'
ID455164
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms4930563P03Rik
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80407959-80469695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80408686 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 158 (D158V)
Ref Sequence ENSEMBL: ENSMUSP00000123705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229] [ENSMUST00000161003]
Predicted Effect unknown
Transcript: ENSMUST00000036229
AA Change: D946V
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: D946V

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160434
Predicted Effect unknown
Transcript: ENSMUST00000161003
AA Change: D158V
SMART Domains Protein: ENSMUSP00000123705
Gene: ENSMUSG00000033323
AA Change: D158V

DomainStartEndE-ValueType
Pfam:FCP1_C 3 172 3.8e-92 PFAM
Meta Mutation Damage Score 0.3695 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80458692 splice site probably null
IGL01695:Ctdp1 APN 18 80449626 missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80455984 missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80455972 missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80420584 missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80450090 missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80450185 missense probably benign
IGL03117:Ctdp1 APN 18 80449501 missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80449634 nonsense probably null
IGL03385:Ctdp1 APN 18 80449918 missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80449354 missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80447422 critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80450242 missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80469521 missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80449487 missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80450213 missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80449401 missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80449481 missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80450213 nonsense probably null
R3724:Ctdp1 UTSW 18 80459267 missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80452351 missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80449957 missense probably benign
R4298:Ctdp1 UTSW 18 80449957 missense probably benign
R4640:Ctdp1 UTSW 18 80451154 critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80408726 missense unknown
R4842:Ctdp1 UTSW 18 80408726 missense unknown
R5007:Ctdp1 UTSW 18 80420480 missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80456088 missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80447460 missense probably damaging 1.00
R5896:Ctdp1 UTSW 18 80458788 missense probably damaging 1.00
R6242:Ctdp1 UTSW 18 80459212 missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80459297 critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80459240 missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80451255 missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80420474 missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80451263 missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80449551 missense probably benign
R6802:Ctdp1 UTSW 18 80420441 critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80440714 splice site probably null
R8121:Ctdp1 UTSW 18 80456008 missense probably damaging 1.00
R8513:Ctdp1 UTSW 18 80449463 missense possibly damaging 0.49
X0020:Ctdp1 UTSW 18 80449990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCTTTGGCATCACACACC -3'
(R):5'- TGTGCTGAGATGACTAAGGGC -3'

Sequencing Primer
(F):5'- AACTCCTCAGAACACTTTGCTG -3'
(R):5'- ATGACTAAGGGCCTGCATGC -3'
Posted On2017-02-10