Incidental Mutation 'R5870:Zfyve27'
ID455168
Institutional Source Beutler Lab
Gene Symbol Zfyve27
Ensembl Gene ENSMUSG00000018820
Gene Namezinc finger, FYVE domain containing 27
Synonymsprotrudin, 2210011N02Rik, 9530077C24Rik
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42163951-42194590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 42171671 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 42 (L42R)
Ref Sequence ENSEMBL: ENSMUSP00000130684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099443] [ENSMUST00000169536]
Predicted Effect probably benign
Transcript: ENSMUST00000099443
AA Change: L42R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097042
Gene: ENSMUSG00000018820
AA Change: L42R

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
FYVE 335 408 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166788
Predicted Effect probably benign
Transcript: ENSMUST00000169536
AA Change: L42R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820
AA Change: L42R

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Meta Mutation Damage Score 0.1217 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Other mutations in Zfyve27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Zfyve27 APN 19 42183433 missense probably benign
IGL02040:Zfyve27 APN 19 42179391 missense probably damaging 1.00
IGL02048:Zfyve27 APN 19 42185857 missense probably damaging 0.99
IGL02135:Zfyve27 APN 19 42184136 missense probably damaging 1.00
Forgotten UTSW 19 42189577 missense probably damaging 1.00
ignored UTSW 19 42171731 missense probably benign 0.01
overlooked UTSW 19 42182657 critical splice acceptor site probably null
R0388:Zfyve27 UTSW 19 42189585 missense probably damaging 1.00
R1589:Zfyve27 UTSW 19 42171745 critical splice donor site probably null
R1908:Zfyve27 UTSW 19 42171548 start codon destroyed probably null 1.00
R2151:Zfyve27 UTSW 19 42171731 missense probably benign 0.01
R2204:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R2205:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R5800:Zfyve27 UTSW 19 42182663 missense probably damaging 1.00
R5819:Zfyve27 UTSW 19 42183496 missense probably benign 0.00
R5959:Zfyve27 UTSW 19 42179448 missense unknown
R6217:Zfyve27 UTSW 19 42189577 missense probably damaging 1.00
R6281:Zfyve27 UTSW 19 42182755 missense probably damaging 1.00
R6337:Zfyve27 UTSW 19 42182657 critical splice acceptor site probably null
R6638:Zfyve27 UTSW 19 42181497 splice site probably null
R7438:Zfyve27 UTSW 19 42189520 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCACACGAACTGTAATGCAAGG -3'
(R):5'- CCCCAGAACTAGTCATCGCTAG -3'

Sequencing Primer
(F):5'- CAAGGGGGAAATGTGTTGTAGTC -3'
(R):5'- AACTAGTCATCGCTAGAGCAG -3'
Posted On2017-02-10