Incidental Mutation 'R5871:Pth2r'
ID455170
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5871 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65388637 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 490 (P490S)
Ref Sequence ENSEMBL: ENSMUSP00000027083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083]
Predicted Effect probably damaging
Transcript: ENSMUST00000027083
AA Change: P490S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: P490S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Ccr5 T C 9: 124,124,521 F54L probably benign Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1158 T C 2: 87,991,011 F300S possibly damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Sec14l5 T A 16: 5,168,853 N168K probably benign Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ubxn1 A G 19: 8,874,212 Q203R probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Usp14 A G 18: 9,996,234 F449L probably benign Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R7919:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R8061:Pth2r UTSW 1 65343501 missense not run
Z1176:Pth2r UTSW 1 65363308 missense not run
Predicted Primers PCR Primer
(F):5'- GTGGACTCGATGGAATCTGTC -3'
(R):5'- TCTGCCAATCCACAGGAACG -3'

Sequencing Primer
(F):5'- GGAATCTGTCCATCGACTGG -3'
(R):5'- CCAATCCACAGGAACGGAAATGG -3'
Posted On2017-02-10