Incidental Mutation 'R5871:Olfr1158'
ID455175
Institutional Source Beutler Lab
Gene Symbol Olfr1158
Ensembl Gene ENSMUSG00000062793
Gene Nameolfactory receptor 1158
SynonymsMOR173-3, GA_x6K02T2Q125-49480812-49481753
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5871 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87990113-87991054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87991011 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 300 (F300S)
Ref Sequence ENSEMBL: ENSMUSP00000099682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102622
AA Change: F300S

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099682
Gene: ENSMUSG00000062793
AA Change: F300S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-45 PFAM
Pfam:7tm_1 41 289 4.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Ccr5 T C 9: 124,124,521 F54L probably benign Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Pth2r C T 1: 65,388,637 P490S probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Sec14l5 T A 16: 5,168,853 N168K probably benign Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ubxn1 A G 19: 8,874,212 Q203R probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Usp14 A G 18: 9,996,234 F449L probably benign Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Olfr1158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1158 APN 2 87990438 missense probably damaging 1.00
IGL01287:Olfr1158 APN 2 87990944 missense probably benign 0.01
IGL01374:Olfr1158 APN 2 87990548 missense probably benign
IGL01821:Olfr1158 APN 2 87990589 missense probably benign 0.12
IGL01832:Olfr1158 APN 2 87990169 missense probably benign 0.02
IGL02327:Olfr1158 APN 2 87990257 missense probably damaging 1.00
IGL02580:Olfr1158 APN 2 87990513 missense probably benign 0.09
IGL03001:Olfr1158 APN 2 87990149 missense probably benign 0.43
IGL03196:Olfr1158 APN 2 87990482 missense possibly damaging 0.67
R0546:Olfr1158 UTSW 2 87990472 nonsense probably null
R1474:Olfr1158 UTSW 2 87990990 missense probably damaging 1.00
R1650:Olfr1158 UTSW 2 87990801 missense probably benign 0.01
R1757:Olfr1158 UTSW 2 87990582 missense probably damaging 0.99
R2992:Olfr1158 UTSW 2 87990777 missense probably benign 0.00
R4038:Olfr1158 UTSW 2 87990918 missense possibly damaging 0.88
R5190:Olfr1158 UTSW 2 87990763 nonsense probably null
R8220:Olfr1158 UTSW 2 87990152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAAAACAGGTTCTGCAGAGG -3'
(R):5'- CCAGTTTCAATGTTAGACACAGTAC -3'

Sequencing Primer
(F):5'- GAAAGAAAGGGTTCTCTACTTGTGC -3'
(R):5'- GACACAGTACTTTCTTTCTTAACGG -3'
Posted On2017-02-10