Incidental Mutation 'R5871:Phtf2'
ID455184
Institutional Source Beutler Lab
Gene Symbol Phtf2
Ensembl Gene ENSMUSG00000039987
Gene Nameputative homeodomain transcription factor 2
Synonyms
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5871 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location20758663-20882124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20794401 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000114087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118174]
Predicted Effect probably benign
Transcript: ENSMUST00000118174
AA Change: V248A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114087
Gene: ENSMUSG00000039987
AA Change: V248A

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 154 1.3e-76 PFAM
low complexity region 340 359 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
transmembrane domain 511 533 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
transmembrane domain 628 647 N/A INTRINSIC
transmembrane domain 715 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140147
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Ccr5 T C 9: 124,124,521 F54L probably benign Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1158 T C 2: 87,991,011 F300S possibly damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Pth2r C T 1: 65,388,637 P490S probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Sec14l5 T A 16: 5,168,853 N168K probably benign Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ubxn1 A G 19: 8,874,212 Q203R probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Usp14 A G 18: 9,996,234 F449L probably benign Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Phtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Phtf2 APN 5 20782267 unclassified probably benign
IGL01789:Phtf2 APN 5 20794374 missense probably benign 0.00
IGL01816:Phtf2 APN 5 20803276 missense probably damaging 1.00
IGL02266:Phtf2 APN 5 20805799 missense probably damaging 1.00
IGL02295:Phtf2 APN 5 20807430 missense probably damaging 1.00
IGL03086:Phtf2 APN 5 20764275 missense probably damaging 0.99
IGL03179:Phtf2 APN 5 20782399 missense probably damaging 1.00
IGL03192:Phtf2 APN 5 20761719 missense probably damaging 0.99
IGL03256:Phtf2 APN 5 20803252 missense probably damaging 0.98
PIT4480001:Phtf2 UTSW 5 20813244 missense probably damaging 1.00
PIT4802001:Phtf2 UTSW 5 20801906 missense probably damaging 0.96
R0589:Phtf2 UTSW 5 20813251 nonsense probably null
R1732:Phtf2 UTSW 5 20789627 critical splice donor site probably null
R3151:Phtf2 UTSW 5 20765804 missense probably damaging 1.00
R3791:Phtf2 UTSW 5 20782298 missense probably damaging 1.00
R3843:Phtf2 UTSW 5 20774022 missense probably damaging 1.00
R4080:Phtf2 UTSW 5 20813296 missense probably damaging 1.00
R4569:Phtf2 UTSW 5 20789595 intron probably benign
R4627:Phtf2 UTSW 5 20773740 missense probably damaging 1.00
R4901:Phtf2 UTSW 5 20805724 missense possibly damaging 0.73
R5131:Phtf2 UTSW 5 20774052 missense probably damaging 1.00
R5276:Phtf2 UTSW 5 20772197 missense probably benign 0.19
R5941:Phtf2 UTSW 5 20774073 missense probably damaging 0.98
R5964:Phtf2 UTSW 5 20775934 missense probably damaging 1.00
R6318:Phtf2 UTSW 5 20801941 missense probably damaging 1.00
R6621:Phtf2 UTSW 5 20812956 intron probably benign
R6684:Phtf2 UTSW 5 20812939 critical splice donor site probably benign
R7003:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R7253:Phtf2 UTSW 5 20765858 missense possibly damaging 0.73
R7566:Phtf2 UTSW 5 20765801 missense probably damaging 1.00
R7654:Phtf2 UTSW 5 20782461 missense probably damaging 0.99
R8117:Phtf2 UTSW 5 20802040 missense probably benign 0.30
R8514:Phtf2 UTSW 5 20802032 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTCAGAGCAGCTACTCCATCAC -3'
(R):5'- ACAGCCCAGGTAATTAAGACTAAG -3'

Sequencing Primer
(F):5'- ATCACTCCACGCTGGCAG -3'
(R):5'- GCCATTAAAATTCTGAGAAATACTGC -3'
Posted On2017-02-10