Mutagenetix > Incidental Mutation

Incidental Mutation 'R5871:Fancd2'

455188

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

043234-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5871 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113556282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 520 (E520G)

Ref Sequence

ENSEMBL: ENSMUSP00000144928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]

AlphaFold

Q80V62

Predicted Effect

probably benign
Transcript: ENSMUST00000036340
AA Change: E520G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: E520G

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000123738
AA Change: E121G

SMART Domains

Protein: ENSMUSP00000122091
Gene: ENSMUSG00000034023
AA Change: E121G

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	246	5.7e-116	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142453

Predicted Effect

probably benign
Transcript: ENSMUST00000204827
AA Change: E520G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: E520G

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	A	T	1: 173,332,073	L293Q	probably damaging	Het
Ankrd13d	A	G	19: 4,281,994	V92A	possibly damaging	Het
Anxa5	T	A	3: 36,452,249	Q218L	possibly damaging	Het
Bend6	T	C	1: 33,863,865	M135V	probably damaging	Het
Ccr5	T	C	9: 124,124,521	F54L	probably benign	Het
Chrng	T	C	1: 87,206,729	V164A	possibly damaging	Het
Clca3a1	T	G	3: 144,754,881	S271R	probably damaging	Het
Csmd3	G	A	15: 47,888,716	T1282I	probably damaging	Het
Dock10	C	A	1: 80,541,340		probably null	Het
Esrrb	A	G	12: 86,505,887	Y196C	probably benign	Het
Fam76a	T	C	4: 132,904,010	D208G	probably damaging	Het
Fgf9	A	T	14: 58,083,199		probably null	Het
Gatb	T	A	3: 85,653,776	L533*	probably null	Het
Gm884	T	C	11: 103,616,454		probably benign	Het
Igsf10	G	T	3: 59,330,411	A783D	possibly damaging	Het
Ldlrap1	A	G	4: 134,758,929	I73T	probably damaging	Het
Msr1	G	A	8: 39,611,652	P327L	probably damaging	Het
Myo18a	T	C	11: 77,832,480	Y823H	probably damaging	Het
Ncapg	A	G	5: 45,695,697	E835G	probably damaging	Het
Nfam1	A	G	15: 83,016,422	S120P	probably damaging	Het
Olfr1158	T	C	2: 87,991,011	F300S	possibly damaging	Het
Olfr1294	A	G	2: 111,537,639	S217P	probably damaging	Het
Olfr679	T	C	7: 105,086,304	V196A	possibly damaging	Het
Olfr913	T	A	9: 38,594,332	I37K	possibly damaging	Het
Phtf2	A	G	5: 20,794,401	V248A	probably benign	Het
Pik3r3	G	T	4: 116,286,158	E283*	probably null	Het
Plcg2	T	A	8: 117,504,217	Y13N	probably damaging	Het
Pth2r	C	T	1: 65,388,637	P490S	probably damaging	Het
Rnf40	T	A	7: 127,591,585	M275K	probably damaging	Het
Rpgrip1l	T	C	8: 91,221,386	E1223G	possibly damaging	Het
Sec14l5	T	A	16: 5,168,853	N168K	probably benign	Het
Siglecf	T	C	7: 43,355,621	V425A	probably benign	Het
Sorbs1	A	G	19: 40,398,583	V13A	probably damaging	Het
Svil	T	A	18: 5,103,669		probably null	Het
Tbrg1	A	G	9: 37,650,982	I300T	probably damaging	Het
Tnni3k	T	A	3: 155,030,370	D112V	probably benign	Het
Ubxn1	A	G	19: 8,874,212	Q203R	probably benign	Het
Ugt1a7c	A	G	1: 88,095,659	D180G	possibly damaging	Het
Usp14	A	G	18: 9,996,234	F449L	probably benign	Het
Wwc2	A	G	8: 47,868,423	L552P	unknown	Het
Zscan10	A	G	17: 23,607,267		probably benign	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACCTGGTAATTGAAGTAGCTGGG -3'
(R):5'- GCACTCAGCATCATGTTACCG -3'

Sequencing Primer
(F):5'- TACATTTGCCAAGGATCCGG -3'
(R):5'- CATTGACCAGGTAGTTTCTACGAC -3'

Posted On

2017-02-10