Incidental Mutation 'R5871:Rnf40'
ID 455191
Institutional Source Beutler Lab
Gene Symbol Rnf40
Ensembl Gene ENSMUSG00000030816
Gene Name ring finger protein 40
Synonyms
MMRRC Submission 043234-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R5871 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127187870-127202777 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127190757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 275 (M275K)
Ref Sequence ENSEMBL: ENSMUSP00000033088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033088] [ENSMUST00000072155] [ENSMUST00000205694] [ENSMUST00000206914]
AlphaFold Q3U319
Predicted Effect probably damaging
Transcript: ENSMUST00000033088
AA Change: M275K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816
AA Change: M275K

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205694
AA Change: M275K

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206220
Predicted Effect possibly damaging
Transcript: ENSMUST00000206914
AA Change: M275K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206724
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,159,640 (GRCm39) L293Q probably damaging Het
Ankrd13d A G 19: 4,332,022 (GRCm39) V92A possibly damaging Het
Anxa5 T A 3: 36,506,398 (GRCm39) Q218L possibly damaging Het
Bend6 T C 1: 33,902,946 (GRCm39) M135V probably damaging Het
Ccr5 T C 9: 123,924,558 (GRCm39) F54L probably benign Het
Chrng T C 1: 87,134,451 (GRCm39) V164A possibly damaging Het
Clca3a1 T G 3: 144,460,642 (GRCm39) S271R probably damaging Het
Csmd3 G A 15: 47,752,112 (GRCm39) T1282I probably damaging Het
Dock10 C A 1: 80,519,057 (GRCm39) probably null Het
Esrrb A G 12: 86,552,661 (GRCm39) Y196C probably benign Het
Fam76a T C 4: 132,631,321 (GRCm39) D208G probably damaging Het
Fancd2 A G 6: 113,533,243 (GRCm39) E520G probably benign Het
Fgf9 A T 14: 58,320,656 (GRCm39) probably null Het
Gatb T A 3: 85,561,083 (GRCm39) L533* probably null Het
Igsf10 G T 3: 59,237,832 (GRCm39) A783D possibly damaging Het
Ldlrap1 A G 4: 134,486,240 (GRCm39) I73T probably damaging Het
Lrrc37 T C 11: 103,507,280 (GRCm39) probably benign Het
Msr1 G A 8: 40,064,693 (GRCm39) P327L probably damaging Het
Myo18a T C 11: 77,723,306 (GRCm39) Y823H probably damaging Het
Ncapg A G 5: 45,853,039 (GRCm39) E835G probably damaging Het
Nfam1 A G 15: 82,900,623 (GRCm39) S120P probably damaging Het
Or4k44 A G 2: 111,367,984 (GRCm39) S217P probably damaging Het
Or56a3 T C 7: 104,735,511 (GRCm39) V196A possibly damaging Het
Or8b49 T A 9: 38,505,628 (GRCm39) I37K possibly damaging Het
Or9m2 T C 2: 87,821,355 (GRCm39) F300S possibly damaging Het
Phtf2 A G 5: 20,999,399 (GRCm39) V248A probably benign Het
Pik3r3 G T 4: 116,143,355 (GRCm39) E283* probably null Het
Plcg2 T A 8: 118,230,956 (GRCm39) Y13N probably damaging Het
Pth2r C T 1: 65,427,796 (GRCm39) P490S probably damaging Het
Rpgrip1l T C 8: 91,948,014 (GRCm39) E1223G possibly damaging Het
Sec14l5 T A 16: 4,986,717 (GRCm39) N168K probably benign Het
Siglecf T C 7: 43,005,045 (GRCm39) V425A probably benign Het
Sorbs1 A G 19: 40,387,027 (GRCm39) V13A probably damaging Het
Svil T A 18: 5,103,669 (GRCm39) probably null Het
Tbrg1 A G 9: 37,562,278 (GRCm39) I300T probably damaging Het
Tnni3k T A 3: 154,736,007 (GRCm39) D112V probably benign Het
Ubxn1 A G 19: 8,851,576 (GRCm39) Q203R probably benign Het
Ugt1a7c A G 1: 88,023,381 (GRCm39) D180G possibly damaging Het
Usp14 A G 18: 9,996,234 (GRCm39) F449L probably benign Het
Wwc2 A G 8: 48,321,458 (GRCm39) L552P unknown Het
Zscan10 A G 17: 23,826,241 (GRCm39) probably benign Het
Other mutations in Rnf40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Rnf40 APN 7 127,189,888 (GRCm39) splice site probably benign
IGL02331:Rnf40 APN 7 127,188,999 (GRCm39) missense probably benign
IGL02626:Rnf40 APN 7 127,195,744 (GRCm39) missense probably damaging 1.00
IGL02867:Rnf40 APN 7 127,190,601 (GRCm39) nonsense probably null
IGL02889:Rnf40 APN 7 127,190,601 (GRCm39) nonsense probably null
IGL03353:Rnf40 APN 7 127,192,063 (GRCm39) nonsense probably null
R0103:Rnf40 UTSW 7 127,199,743 (GRCm39) missense probably damaging 1.00
R0103:Rnf40 UTSW 7 127,199,743 (GRCm39) missense probably damaging 1.00
R0133:Rnf40 UTSW 7 127,196,032 (GRCm39) splice site probably null
R0554:Rnf40 UTSW 7 127,201,756 (GRCm39) missense probably damaging 1.00
R0563:Rnf40 UTSW 7 127,192,048 (GRCm39) missense probably damaging 1.00
R1523:Rnf40 UTSW 7 127,189,787 (GRCm39) missense probably damaging 0.99
R1551:Rnf40 UTSW 7 127,195,506 (GRCm39) missense possibly damaging 0.88
R1804:Rnf40 UTSW 7 127,195,120 (GRCm39) missense possibly damaging 0.59
R1929:Rnf40 UTSW 7 127,190,956 (GRCm39) missense probably damaging 0.99
R2194:Rnf40 UTSW 7 127,196,407 (GRCm39) missense probably damaging 1.00
R2356:Rnf40 UTSW 7 127,190,748 (GRCm39) missense probably damaging 0.99
R4839:Rnf40 UTSW 7 127,191,812 (GRCm39) nonsense probably null
R5071:Rnf40 UTSW 7 127,196,458 (GRCm39) missense probably damaging 1.00
R5074:Rnf40 UTSW 7 127,196,458 (GRCm39) missense probably damaging 1.00
R5292:Rnf40 UTSW 7 127,195,120 (GRCm39) missense possibly damaging 0.59
R5537:Rnf40 UTSW 7 127,195,261 (GRCm39) missense probably benign 0.05
R5547:Rnf40 UTSW 7 127,188,302 (GRCm39) critical splice donor site probably null
R6767:Rnf40 UTSW 7 127,195,757 (GRCm39) missense possibly damaging 0.88
R6834:Rnf40 UTSW 7 127,195,578 (GRCm39) missense probably benign 0.18
R6969:Rnf40 UTSW 7 127,195,495 (GRCm39) missense possibly damaging 0.89
R6980:Rnf40 UTSW 7 127,193,849 (GRCm39) missense probably damaging 1.00
R7626:Rnf40 UTSW 7 127,189,047 (GRCm39) missense probably benign
R8177:Rnf40 UTSW 7 127,195,322 (GRCm39) missense probably benign
R8719:Rnf40 UTSW 7 127,191,834 (GRCm39) missense probably damaging 1.00
R8798:Rnf40 UTSW 7 127,188,954 (GRCm39) missense probably damaging 1.00
R8817:Rnf40 UTSW 7 127,196,332 (GRCm39) missense probably damaging 1.00
R9160:Rnf40 UTSW 7 127,190,993 (GRCm39) missense probably damaging 1.00
R9299:Rnf40 UTSW 7 127,188,172 (GRCm39) missense probably benign 0.01
R9337:Rnf40 UTSW 7 127,188,172 (GRCm39) missense probably benign 0.01
R9462:Rnf40 UTSW 7 127,191,010 (GRCm39) critical splice donor site probably null
R9464:Rnf40 UTSW 7 127,190,954 (GRCm39) missense probably benign 0.06
R9469:Rnf40 UTSW 7 127,195,769 (GRCm39) missense probably damaging 1.00
R9476:Rnf40 UTSW 7 127,201,808 (GRCm39) missense probably damaging 1.00
R9510:Rnf40 UTSW 7 127,201,808 (GRCm39) missense probably damaging 1.00
X0026:Rnf40 UTSW 7 127,193,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGGACTTGGCCACTCAG -3'
(R):5'- ACACATAGTAGCCGGAGTTGAG -3'

Sequencing Primer
(F):5'- TTGGCCACTCAGCTGCAAG -3'
(R):5'- TAGCCGGAGTTGAGCTGCAG -3'
Posted On 2017-02-10