Mutagenetix > Incidental Mutation

Incidental Mutation 'R0555:Greb1l'

45520

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

038747-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0555 (G1)

Quality Score

190

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 10458781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (98/98)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	T	A	9: 70,754,234	I363N	probably damaging	Het
Ahcyl2	T	C	6: 29,890,671		probably benign	Het
Asap1	A	G	15: 64,094,364	L941P	probably damaging	Het
Aurka	G	A	2: 172,367,147	R23C	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Casp8ap2	T	A	4: 32,640,381	H478Q	probably damaging	Het
Clcn4	C	T	7: 7,290,504	A418T	possibly damaging	Het
Cpxm2	A	T	7: 132,044,043	Y715*	probably null	Het
Csmd1	T	C	8: 16,185,273	M1179V	probably benign	Het
Ddx21	A	T	10: 62,587,528	F632I	probably damaging	Het
Dnaic1	C	A	4: 41,625,335	T433K	possibly damaging	Het
Dpyd	G	A	3: 119,431,542	G988D	probably damaging	Het
Dync1i2	AAAAGAAGAGGAAAGAAGAGGAAAG	AAAAGAAGAGGAAAG	2: 71,214,518		probably null	Het
Dync1li2	A	T	8: 104,420,665	S466T	probably benign	Het
Ears2	T	C	7: 122,048,444	T206A	probably benign	Het
Elmod1	A	T	9: 53,931,592		probably benign	Het
Eps8l3	C	A	3: 107,892,345	D590E	probably benign	Het
Etfdh	A	T	3: 79,605,805	H370Q	probably benign	Het
Fam83g	C	A	11: 61,707,663	A792E	probably benign	Het
Ffar3	G	T	7: 30,855,537	Y119*	probably null	Het
Fosb	G	T	7: 19,307,213	S118R	possibly damaging	Het
Foxn4	G	A	5: 114,263,114	L3F	probably damaging	Het
Foxo4	A	G	X: 101,255,178	K65E	probably damaging	Het
Frem2	A	G	3: 53,516,860	L3052P	probably damaging	Het
Fubp3	G	A	2: 31,608,137	R101H	probably damaging	Het
Gba2	C	A	4: 43,569,927	G429C	probably damaging	Het
Gimap1	T	C	6: 48,741,429		probably benign	Het
Gm17657	A	T	17: 29,519,571	F74I	probably benign	Het
Gnas	A	G	2: 174,298,511	T158A	possibly damaging	Het
Gpc5	T	C	14: 115,552,328	V538A	probably damaging	Het
H2-M10.5	G	A	17: 36,774,728	G260R	probably damaging	Het
Hbs1l	A	C	10: 21,349,323	Q412H	probably benign	Het
Hecw1	G	T	13: 14,236,941	T1058N	probably damaging	Het
Heph	A	T	X: 96,558,084	T1027S	probably damaging	Het
Hoga1	A	C	19: 42,046,075	E53A	possibly damaging	Het
Insrr	T	G	3: 87,814,437		probably benign	Het
Ipo11	A	T	13: 106,892,461	V328D	probably damaging	Het
Jakmip1	T	C	5: 37,118,873	V509A	probably damaging	Het
Jmjd1c	T	C	10: 67,225,789	V1307A	probably benign	Het
Kmt2a	T	A	9: 44,847,571	S1027C	probably damaging	Het
Kprp	G	C	3: 92,824,357	P462R	unknown	Het
Lman1l	T	C	9: 57,614,101	T193A	probably benign	Het
Lrit3	A	T	3: 129,791,296	V271D	probably damaging	Het
Map4	T	A	9: 109,979,103		probably benign	Het
Mark4	A	C	7: 19,448,673		probably benign	Het
Mfsd14b	A	G	13: 65,078,445	V142A	probably benign	Het
Mis18bp1	A	T	12: 65,161,453	I162N	possibly damaging	Het
Mrpl43	A	T	19: 45,005,952		probably benign	Het
Mrpl47	A	G	3: 32,736,693	F16S	probably benign	Het
Myh2	G	T	11: 67,178,967	G380C	probably damaging	Het
Myo15	T	C	11: 60,521,638	Y3284H	probably damaging	Het
Nectin2	A	G	7: 19,733,223		probably benign	Het
Neu3	A	G	7: 99,814,183	V111A	probably damaging	Het
Nol4l	T	C	2: 153,417,684		probably null	Het
Nphp3	C	A	9: 104,023,434	H510Q	probably damaging	Het
Nprl3	T	A	11: 32,233,118		probably null	Het
Olfr292	A	G	7: 86,695,308	N284S	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr598	T	C	7: 103,328,963	V159A	probably benign	Het
Olfr791	T	C	10: 129,526,896	I223T	possibly damaging	Het
Pex1	A	G	5: 3,606,130	E319G	possibly damaging	Het
Phtf1	C	A	3: 104,004,469	T709K	probably damaging	Het
Plek2	A	T	12: 78,892,172	L271Q	probably damaging	Het
Plekhg5	T	A	4: 152,107,469	C421*	probably null	Het
Polk	A	C	13: 96,484,179	C525W	probably damaging	Het
Ppfibp2	T	C	7: 107,729,174	S471P	probably damaging	Het
Prickle2	A	T	6: 92,458,565	F74L	probably benign	Het
Prl7d1	A	T	13: 27,712,055	V113D	probably benign	Het
Prr14	C	T	7: 127,472,095		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ret	A	G	6: 118,178,610	V375A	probably damaging	Het
Rora	T	C	9: 69,361,746	F41S	probably damaging	Het
Sall1	T	C	8: 89,031,758	T573A	probably benign	Het
Shb	A	G	4: 45,458,321	V281A	possibly damaging	Het
Slc25a26	A	T	6: 94,592,410		probably null	Het
Sltm	T	C	9: 70,586,081	F769L	probably damaging	Het
Snx9	T	A	17: 5,918,413	M328K	probably damaging	Het
Stk25	G	T	1: 93,624,591	Q356K	probably benign	Het
Svep1	T	A	4: 58,128,858	Y613F	possibly damaging	Het
Syne4	G	A	7: 30,316,744	A195T	probably damaging	Het
Tmem8	T	C	17: 26,117,114	L130S	probably benign	Het
Trcg1	C	T	9: 57,242,333	T396M	probably damaging	Het
Trim30b	A	G	7: 104,357,298	V117A	possibly damaging	Het
Trpc4	T	C	3: 54,302,090		probably benign	Het
Ttll4	A	G	1: 74,688,280	H827R	probably damaging	Het
Urgcp	T	C	11: 5,717,477	E287G	probably damaging	Het
Usp2	G	T	9: 44,092,784	L319F	probably damaging	Het
Vmn1r167	A	T	7: 23,505,087	V168D	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r61	A	T	7: 42,266,018	I130F	probably benign	Het
Vmn2r63	A	T	7: 42,928,528	Y195*	probably null	Het
Vmn2r81	T	C	10: 79,293,449	S725P	probably damaging	Het
Wnt10b	A	G	15: 98,772,937		probably benign	Het
Zcchc6	A	G	13: 59,800,317	V328A	probably benign	Het
Zfp292	T	C	4: 34,807,194	E1950G	probably damaging	Het
Zfyve16	A	G	13: 92,516,520		probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTACTTGGACCCAGACCAGCATC -3'
(R):5'- CGTGAACCCCAGTGTCTTCATCTAC -3'

Sequencing Primer
(F):5'- GCAGGTAAGTTTCTCAATTACAGGC -3'
(R):5'- CCAGTGTCTTCATCTACAAGAGTG -3'

Posted On

2013-06-11