Incidental Mutation 'R5871:Ccr5'
ID455200
Institutional Source Beutler Lab
Gene Symbol Ccr5
Ensembl Gene ENSMUSG00000079227
Gene Namechemokine (C-C motif) receptor 5
SynonymsCmkbr5, CD195
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5871 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location124121543-124147699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124124521 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 54 (F54L)
Ref Sequence ENSEMBL: ENSMUSP00000127328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111442] [ENSMUST00000168179] [ENSMUST00000171499]
Predicted Effect probably benign
Transcript: ENSMUST00000097855
Predicted Effect probably benign
Transcript: ENSMUST00000111442
AA Change: F54L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107069
Gene: ENSMUSG00000079227
AA Change: F54L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 314 3.8e-6 PFAM
Pfam:7tm_1 49 299 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169553
Predicted Effect probably benign
Transcript: ENSMUST00000171499
AA Change: F54L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127328
Gene: ENSMUSG00000079227
AA Change: F54L

DomainStartEndE-ValueType
Pfam:7tm_1 49 123 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171579
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice that are homozygous for null alleles have leukocytes with defective migration and adhesion, are more susceptibility to fungal & bacterial infections, have increased length of allograft survival, and have decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1158 T C 2: 87,991,011 F300S possibly damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Pth2r C T 1: 65,388,637 P490S probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Sec14l5 T A 16: 5,168,853 N168K probably benign Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ubxn1 A G 19: 8,874,212 Q203R probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Usp14 A G 18: 9,996,234 F449L probably benign Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Ccr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ccr5 APN 9 124124406 missense possibly damaging 0.59
IGL00551:Ccr5 APN 9 124124588 missense probably damaging 1.00
IGL01153:Ccr5 APN 9 124124612 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0355:Ccr5 UTSW 9 124124914 missense possibly damaging 0.90
R1570:Ccr5 UTSW 9 124124963 missense probably benign 0.29
R4305:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4307:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4570:Ccr5 UTSW 9 124124875 nonsense probably null
R4589:Ccr5 UTSW 9 124124502 missense probably benign 0.00
R5549:Ccr5 UTSW 9 124125371 missense probably benign 0.09
R5566:Ccr5 UTSW 9 124124660 missense probably benign 0.07
R6568:Ccr5 UTSW 9 124125199 missense probably damaging 0.99
R7258:Ccr5 UTSW 9 124125274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATAGGCTCTTGCAGGATGG -3'
(R):5'- CAAGTACCTATCAATTGTCAGGAGG -3'

Sequencing Primer
(F):5'- GATTTTCAAGGGTCAGTTCCGACC -3'
(R):5'- TAACCAATGTGATAGAGCCCTGTG -3'
Posted On2017-02-10