Incidental Mutation 'R5871:Usp14'
ID455211
Institutional Source Beutler Lab
Gene Symbol Usp14
Ensembl Gene ENSMUSG00000047879
Gene Nameubiquitin specific peptidase 14
Synonyms2610005K12Rik, ataxia, NMF375, nmf375, dUB-type TGT, ax, 2610037B11Rik
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5871 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9995432-10045119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9996234 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 449 (F449L)
Ref Sequence ENSEMBL: ENSMUSP00000089728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025137] [ENSMUST00000092096] [ENSMUST00000116669]
PDB Structure
Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000025137
SMART Domains Protein: ENSMUSP00000025137
Gene: ENSMUSG00000024287

DomainStartEndE-ValueType
Pfam:efThoc1 69 546 7.2e-149 PFAM
DEATH 560 653 1.27e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092096
AA Change: F449L

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879
AA Change: F449L

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116669
AA Change: F414L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879
AA Change: F414L

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133594
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic mutation develop severe tremors by 3 weeks of age, followed by hindlimb paralysis and premature death. An underdeveloped corpus callosum, hippocampus, dentate gyrus and forebrain structures, and notable defects in synaptic transmission in both the CNS and PNS are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Ccr5 T C 9: 124,124,521 F54L probably benign Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1158 T C 2: 87,991,011 F300S possibly damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Pth2r C T 1: 65,388,637 P490S probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Sec14l5 T A 16: 5,168,853 N168K probably benign Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ubxn1 A G 19: 8,874,212 Q203R probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Usp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02671:Usp14 APN 18 9997196 missense probably damaging 0.99
IGL02756:Usp14 APN 18 10001769 critical splice donor site probably null
PIT4354001:Usp14 UTSW 18 9996189 missense probably damaging 1.00
R1238:Usp14 UTSW 18 9997763 missense probably benign
R1343:Usp14 UTSW 18 10016623 missense probably benign 0.03
R1365:Usp14 UTSW 18 10000490 splice site probably null
R1495:Usp14 UTSW 18 10004994 missense probably benign 0.01
R1817:Usp14 UTSW 18 10024673 missense probably damaging 1.00
R2021:Usp14 UTSW 18 10024632 missense probably damaging 0.99
R2190:Usp14 UTSW 18 10007835 missense probably damaging 1.00
R3836:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3837:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3838:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3839:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3870:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R3871:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R5388:Usp14 UTSW 18 10018023 missense probably damaging 1.00
R5767:Usp14 UTSW 18 10009935 intron probably benign
R5898:Usp14 UTSW 18 10022819 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATGCACAAGTGGCTTGGTTC -3'
(R):5'- CTGCAGCATGTACTAGGAACAG -3'

Sequencing Primer
(F):5'- CACAAGTGGCTTGGTTCTGTTCTC -3'
(R):5'- GAAGTTAAGAATAGCTGTGATGTCAC -3'
Posted On2017-02-10