Incidental Mutation 'R5871:Ubxn1'
ID455213
Institutional Source Beutler Lab
Gene Symbol Ubxn1
Ensembl Gene ENSMUSG00000071655
Gene NameUBX domain protein 1
SynonymsD19Ertd721e, 4930455J02Rik, T25529
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5871 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8871559-8875663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8874212 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 203 (Q203R)
Ref Sequence ENSEMBL: ENSMUSP00000133250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096255] [ENSMUST00000166407]
Predicted Effect probably benign
Transcript: ENSMUST00000096255
AA Change: Q203R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093974
Gene: ENSMUSG00000071655
AA Change: Q203R

DomainStartEndE-ValueType
UBA 3 41 3.7e-9 SMART
low complexity region 73 82 N/A INTRINSIC
coiled coil region 86 174 N/A INTRINSIC
UBX 206 293 3.74e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166407
AA Change: Q203R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133250
Gene: ENSMUSG00000071655
AA Change: Q203R

DomainStartEndE-ValueType
UBA 3 41 3.7e-9 SMART
low complexity region 73 82 N/A INTRINSIC
coiled coil region 86 174 N/A INTRINSIC
UBX 206 293 3.74e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Ccr5 T C 9: 124,124,521 F54L probably benign Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1158 T C 2: 87,991,011 F300S possibly damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Pth2r C T 1: 65,388,637 P490S probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Sec14l5 T A 16: 5,168,853 N168K probably benign Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Usp14 A G 18: 9,996,234 F449L probably benign Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Ubxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0648:Ubxn1 UTSW 19 8874248 missense probably damaging 1.00
R0662:Ubxn1 UTSW 19 8875197 splice site probably null
R2060:Ubxn1 UTSW 19 8873566 nonsense probably null
R2128:Ubxn1 UTSW 19 8872070 missense probably benign
R2961:Ubxn1 UTSW 19 8873803 missense probably damaging 1.00
R4560:Ubxn1 UTSW 19 8874224 missense probably benign 0.00
R4704:Ubxn1 UTSW 19 8872035 missense probably benign 0.02
R5875:Ubxn1 UTSW 19 8872220 missense probably benign
R6818:Ubxn1 UTSW 19 8873881 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGATTTGCCTTGTCCATGTCTG -3'
(R):5'- GATGGGCAGGTGAAATTTGATC -3'

Sequencing Primer
(F):5'- GAGGCAATTTTACTCTAGCCCAG -3'
(R):5'- GGCAGGTGAAATTTGATCTTTCC -3'
Posted On2017-02-10