Incidental Mutation 'R5872:Trmt1l'
ID455216
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene NametRNA methyltransferase 1 like
SynonymsTrm1-like, 1190005F20Rik
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5872 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location151428542-151458161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 151440843 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 32 (I32S)
Ref Sequence ENSEMBL: ENSMUSP00000140009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]
Predicted Effect probably damaging
Transcript: ENSMUST00000065625
AA Change: I185S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: I185S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably damaging
Transcript: ENSMUST00000189655
AA Change: I32S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286
AA Change: I32S

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198467
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
Canyonlands UTSW 1 151454048 nonsense probably null
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151433830 missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R3972:Trmt1l UTSW 1 151433883 missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151448343 nonsense probably null
R4614:Trmt1l UTSW 1 151454048 nonsense probably null
R4617:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6333:Trmt1l UTSW 1 151453934 missense probably benign 0.15
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
R7269:Trmt1l UTSW 1 151457788 missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151440840 missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151440888 missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151442674 missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151435738 missense probably benign 0.02
R8257:Trmt1l UTSW 1 151428878 start codon destroyed probably null
R8286:Trmt1l UTSW 1 151457792 missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151449976 missense probably benign 0.10
R8451:Trmt1l UTSW 1 151448288 missense unknown
R8514:Trmt1l UTSW 1 151453991 missense probably damaging 0.98
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151453113 missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGCCTGCTAGAACAAAGTGTATATAAG -3'
(R):5'- ACTGATGTGAAAACATGATACTGCC -3'

Sequencing Primer
(F):5'- AGCATCACTAGTGAAATGATTCTTTC -3'
(R):5'- AAGAGCACTGACTGTTCTGC -3'
Posted On2017-02-10