Incidental Mutation 'R5872:Atp1a4'
ID455218
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene NameATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5872 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172223513-172258414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172244408 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 432 (L432Q)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
Predicted Effect probably damaging
Transcript: ENSMUST00000111243
AA Change: L432Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: L432Q

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193316
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172239806 missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172246772 missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172257907 missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172246724 missense probably benign
IGL02156:Atp1a4 APN 1 172257962 missense probably benign
IGL02170:Atp1a4 APN 1 172234536 missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172254885 missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172235075 missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172251406 missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172227299 critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172244086 missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172231151 missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172257901 missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172234987 missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172239688 splice site probably benign
R0615:Atp1a4 UTSW 1 172232060 splice site probably benign
R0730:Atp1a4 UTSW 1 172240207 splice site probably benign
R1412:Atp1a4 UTSW 1 172232009 missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172254903 missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172235048 missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172240164 missense probably benign
R2291:Atp1a4 UTSW 1 172244906 missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172246690 missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172234477 missense probably benign
R3119:Atp1a4 UTSW 1 172239826 missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172233961 missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172234431 missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172239765 missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172235000 missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172254110 nonsense probably null
R4958:Atp1a4 UTSW 1 172231151 missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172254082 missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172232005 missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172227170 missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172246832 missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172254163 missense probably damaging 0.99
R5933:Atp1a4 UTSW 1 172232274 missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172258050 unclassified probably benign
R7087:Atp1a4 UTSW 1 172246702 missense probably damaging 1.00
R7122:Atp1a4 UTSW 1 172231936 missense possibly damaging 0.47
R7381:Atp1a4 UTSW 1 172240115 missense possibly damaging 0.70
R7431:Atp1a4 UTSW 1 172250907 missense probably benign 0.31
Z1176:Atp1a4 UTSW 1 172231954 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGGTATACCATCCGGACAAG -3'
(R):5'- AAGTGAATAACCCCTGCTGCG -3'

Sequencing Primer
(F):5'- GTATACCATCCGGACAAGCAGAG -3'
(R):5'- CGCGCCTTATGTAGCTGAGAATG -3'
Posted On2017-02-10