Incidental Mutation 'R0555:Mrpl43'
ID45523
Institutional Source Beutler Lab
Gene Symbol Mrpl43
Ensembl Gene ENSMUSG00000025208
Gene Namemitochondrial ribosomal protein L43
Synonyms4930442D21Rik, bMRP36a
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R0555 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45005014-45006442 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45005952 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000026227] [ENSMUST00000097715] [ENSMUST00000130549] [ENSMUST00000179305]
Predicted Effect probably benign
Transcript: ENSMUST00000026225
SMART Domains Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026227
SMART Domains Protein: ENSMUSP00000026227
Gene: ENSMUSG00000025209

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
Blast:TOPRIM 260 331 8e-16 BLAST
Pfam:AAA_25 377 565 5.6e-25 PFAM
Pfam:DnaB_C 390 631 6.7e-17 PFAM
Pfam:KaiC 394 628 2.6e-11 PFAM
low complexity region 650 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097715
SMART Domains Protein: ENSMUSP00000095322
Gene: ENSMUSG00000025208

DomainStartEndE-ValueType
L51_S25_CI-B8 35 108 1.61e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130549
SMART Domains Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179305
SMART Domains Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Sema 56 487 2.38e-165 SMART
PSI 505 556 6.59e-13 SMART
IG 567 649 6.26e-5 SMART
low complexity region 650 666 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 701 708 N/A INTRINSIC
low complexity region 713 720 N/A INTRINSIC
low complexity region 734 751 N/A INTRINSIC
low complexity region 761 774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Mrpl43
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1162:Mrpl43 UTSW 19 45006358 missense possibly damaging 0.94
R2975:Mrpl43 UTSW 19 45006059 splice site probably null
R4151:Mrpl43 UTSW 19 45005736 missense possibly damaging 0.51
R4345:Mrpl43 UTSW 19 45006110 missense probably damaging 1.00
R4586:Mrpl43 UTSW 19 45005889 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCATCGAAGCTGGAGCAGAATC -3'
(R):5'- AGGAGTCGTAGTATACGTGAACCCG -3'

Sequencing Primer
(F):5'- AGCAGAATCCCGGAGTTCTC -3'
(R):5'- GAATAGTGGCCGAATACCGT -3'
Posted On2013-06-11