Incidental Mutation 'R5872:Vmn2r14'
ID 455237
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission 044079-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R5872 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 109362822-109372488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109369222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 117 (I117T)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: I117T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: I117T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,309 (GRCm39) S1219P possibly damaging Het
A2ml1 A G 6: 128,538,489 (GRCm39) Y644H probably damaging Het
Abca9 T G 11: 110,007,902 (GRCm39) R1232S possibly damaging Het
Acsf2 C T 11: 94,463,975 (GRCm39) V70M probably benign Het
Ampd1 A G 3: 102,986,446 (GRCm39) I42V probably benign Het
Arhgap10 A G 8: 78,071,267 (GRCm39) probably null Het
Atp1a4 A T 1: 172,071,975 (GRCm39) L432Q probably damaging Het
Bbs12 T A 3: 37,374,598 (GRCm39) C349S possibly damaging Het
Bnc2 A G 4: 84,211,007 (GRCm39) V479A possibly damaging Het
Cald1 A T 6: 34,748,043 (GRCm39) K761* probably null Het
Cd177 C T 7: 24,451,688 (GRCm39) G443R probably null Het
Cdc42bpb T C 12: 111,292,410 (GRCm39) D375G probably damaging Het
Chsy3 T C 18: 59,309,268 (GRCm39) Y174H probably damaging Het
Cmya5 T C 13: 93,233,943 (GRCm39) M382V probably benign Het
Col1a2 G A 6: 4,531,926 (GRCm39) S782N unknown Het
Crtac1 C T 19: 42,297,629 (GRCm39) probably null Het
Csmd3 T A 15: 47,445,923 (GRCm39) D3683V probably damaging Het
Ctrc A G 4: 141,572,354 (GRCm39) L62P probably damaging Het
Cyp3a57 A T 5: 145,307,867 (GRCm39) K208* probably null Het
Dnaaf2 A T 12: 69,244,122 (GRCm39) L313Q probably damaging Het
Dtl A G 1: 191,278,680 (GRCm39) L394P probably benign Het
Ehhadh T C 16: 21,585,305 (GRCm39) E192G probably benign Het
Fads2 T C 19: 10,059,997 (GRCm39) I226V probably benign Het
Fat2 T C 11: 55,161,208 (GRCm39) E3174G probably damaging Het
Galnt14 C T 17: 73,881,826 (GRCm39) R91Q probably damaging Het
Hdhd5 G T 6: 120,487,252 (GRCm39) D368E probably benign Het
Hk3 T A 13: 55,158,617 (GRCm39) I528F probably damaging Het
Il10ra A C 9: 45,166,951 (GRCm39) S533R possibly damaging Het
Itpr3 G T 17: 27,305,950 (GRCm39) K169N probably benign Het
Lrrc17 A G 5: 21,780,264 (GRCm39) T413A probably benign Het
Mcm2 C T 6: 88,861,053 (GRCm39) D882N probably benign Het
Met T C 6: 17,562,197 (GRCm39) V1186A probably damaging Het
Msh5 C T 17: 35,248,628 (GRCm39) probably null Het
Nav3 T C 10: 109,600,648 (GRCm39) I1326M probably damaging Het
Nek10 A G 14: 14,850,896 (GRCm38) I314V probably benign Het
Or10g1 A C 14: 52,648,225 (GRCm39) F35V probably damaging Het
Or8b53 T A 9: 38,667,412 (GRCm39) Y143N probably benign Het
Pim1 A G 17: 29,712,720 (GRCm39) E211G probably damaging Het
Plaat1 T A 16: 29,039,189 (GRCm39) Y90N probably benign Het
Ppp1r12b A T 1: 134,704,144 (GRCm39) D903E probably benign Het
Ptpn14 T C 1: 189,583,229 (GRCm39) L692P probably benign Het
Ptprt A G 2: 161,977,138 (GRCm39) C387R probably damaging Het
Qrfprl A G 6: 65,418,369 (GRCm39) probably benign Het
Scarb1 A G 5: 125,381,341 (GRCm39) Y68H possibly damaging Het
Shisa6 T A 11: 66,108,800 (GRCm39) D359V probably damaging Het
Shprh T C 10: 11,063,817 (GRCm39) S1297P probably damaging Het
Sik1 T C 17: 32,069,125 (GRCm39) D250G probably damaging Het
Slamf7 A G 1: 171,466,635 (GRCm39) L190S probably damaging Het
Slc22a3 G A 17: 12,652,355 (GRCm39) P423L probably damaging Het
Slc35e2 A T 4: 155,697,137 (GRCm39) E217V probably damaging Het
Spocd1 A T 4: 129,850,254 (GRCm39) N760I probably damaging Het
Tas2r136 G T 6: 132,754,294 (GRCm39) P278T possibly damaging Het
Tchhl1 A T 3: 93,377,836 (GRCm39) Q180L probably benign Het
Tmem151b T A 17: 45,858,010 (GRCm39) T79S probably benign Het
Tomm70a T A 16: 56,965,105 (GRCm39) C430S probably benign Het
Trbv16 T A 6: 41,128,936 (GRCm39) L40Q probably damaging Het
Trmt1l T G 1: 151,316,594 (GRCm39) I32S probably damaging Het
Ubr4 A G 4: 139,152,641 (GRCm39) T2011A probably damaging Het
Urb1 C T 16: 90,569,652 (GRCm39) W1358* probably null Het
Usp31 T G 7: 121,248,698 (GRCm39) H915P probably benign Het
Vmn2r10 A T 5: 109,151,377 (GRCm39) M79K possibly damaging Het
Vps13b A G 15: 35,869,497 (GRCm39) H2667R possibly damaging Het
Vwa5b1 G A 4: 138,305,962 (GRCm39) T912M possibly damaging Het
Zfp709 G A 8: 72,643,363 (GRCm39) C264Y probably benign Het
Zkscan5 A G 5: 145,156,898 (GRCm39) I467V probably benign Het
Zxdc A T 6: 90,347,281 (GRCm39) D214V probably damaging Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109,364,180 (GRCm39) nonsense probably null
IGL01504:Vmn2r14 APN 5 109,369,285 (GRCm39) missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109,372,443 (GRCm39) missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109,368,275 (GRCm39) missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109,372,349 (GRCm39) missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109,367,933 (GRCm39) missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109,368,454 (GRCm39) nonsense probably null
IGL02676:Vmn2r14 APN 5 109,367,882 (GRCm39) missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109,369,305 (GRCm39) missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109,368,054 (GRCm39) missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109,369,292 (GRCm39) missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109,364,260 (GRCm39) missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109,363,973 (GRCm39) missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109,368,350 (GRCm39) missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109,367,702 (GRCm39) missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109,366,910 (GRCm39) missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109,366,762 (GRCm39) missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109,364,226 (GRCm39) missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109,372,440 (GRCm39) missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109,364,117 (GRCm39) missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109,367,838 (GRCm39) missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109,366,913 (GRCm39) nonsense probably null
R2013:Vmn2r14 UTSW 5 109,369,109 (GRCm39) missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109,366,698 (GRCm39) splice site probably null
R2417:Vmn2r14 UTSW 5 109,372,329 (GRCm39) missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109,363,776 (GRCm39) missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109,372,431 (GRCm39) missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109,364,095 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109,368,033 (GRCm39) missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109,369,370 (GRCm39) missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109,363,976 (GRCm39) missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109,369,384 (GRCm39) splice site probably null
R4896:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109,363,961 (GRCm39) missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109,365,442 (GRCm39) missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109,369,154 (GRCm39) missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109,368,261 (GRCm39) missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109,367,816 (GRCm39) missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109,365,486 (GRCm39) missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109,363,724 (GRCm39) missense possibly damaging 0.49
R5985:Vmn2r14 UTSW 5 109,368,082 (GRCm39) missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109,369,133 (GRCm39) missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109,364,096 (GRCm39) missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109,364,140 (GRCm39) missense probably benign 0.06
R6944:Vmn2r14 UTSW 5 109,363,925 (GRCm39) missense probably benign 0.22
R7608:Vmn2r14 UTSW 5 109,369,276 (GRCm39) missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109,368,086 (GRCm39) missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109,369,219 (GRCm39) missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109,368,420 (GRCm39) missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109,369,342 (GRCm39) missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109,369,340 (GRCm39) missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109,365,533 (GRCm39) missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109,367,893 (GRCm39) missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109,368,054 (GRCm39) missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109,367,902 (GRCm39) nonsense probably null
R9150:Vmn2r14 UTSW 5 109,367,783 (GRCm39) missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109,364,087 (GRCm39) missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109,369,112 (GRCm39) missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109,369,288 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109,368,176 (GRCm39) missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109,368,428 (GRCm39) missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109,367,962 (GRCm39) missense probably benign 0.00
R9678:Vmn2r14 UTSW 5 109,364,041 (GRCm39) missense probably damaging 1.00
R9774:Vmn2r14 UTSW 5 109,369,126 (GRCm39) missense probably benign 0.07
Z1177:Vmn2r14 UTSW 5 109,367,741 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTTGTAGGCACATGTAAATGGAC -3'
(R):5'- GTAATCTAGTTCAAGGTTGGCATTC -3'

Sequencing Primer
(F):5'- GAGTTCAATTCCCAGTAACCATGTGG -3'
(R):5'- GTTCAAGGTTGGCATTCAATAAAAC -3'
Posted On 2017-02-10