Incidental Mutation 'R5872:Scarb1'
ID 455238
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Name scavenger receptor class B, member 1
Synonyms Cd36l1, Srb1, Hdlq1, SRBI, D5Ertd460e, Chohd1, SR-BI, Cla-1, Chohd1, Hlb398
MMRRC Submission 044079-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5872 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 125354151-125418158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125381341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 68 (Y68H)
Ref Sequence ENSEMBL: ENSMUSP00000107021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000137783]
AlphaFold Q61009
Predicted Effect possibly damaging
Transcript: ENSMUST00000086075
AA Change: Y68H

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: Y68H

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111390
AA Change: Y68H

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: Y68H

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133624
Predicted Effect unknown
Transcript: ENSMUST00000137783
AA Change: L56P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156532
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,309 (GRCm39) S1219P possibly damaging Het
A2ml1 A G 6: 128,538,489 (GRCm39) Y644H probably damaging Het
Abca9 T G 11: 110,007,902 (GRCm39) R1232S possibly damaging Het
Acsf2 C T 11: 94,463,975 (GRCm39) V70M probably benign Het
Ampd1 A G 3: 102,986,446 (GRCm39) I42V probably benign Het
Arhgap10 A G 8: 78,071,267 (GRCm39) probably null Het
Atp1a4 A T 1: 172,071,975 (GRCm39) L432Q probably damaging Het
Bbs12 T A 3: 37,374,598 (GRCm39) C349S possibly damaging Het
Bnc2 A G 4: 84,211,007 (GRCm39) V479A possibly damaging Het
Cald1 A T 6: 34,748,043 (GRCm39) K761* probably null Het
Cd177 C T 7: 24,451,688 (GRCm39) G443R probably null Het
Cdc42bpb T C 12: 111,292,410 (GRCm39) D375G probably damaging Het
Chsy3 T C 18: 59,309,268 (GRCm39) Y174H probably damaging Het
Cmya5 T C 13: 93,233,943 (GRCm39) M382V probably benign Het
Col1a2 G A 6: 4,531,926 (GRCm39) S782N unknown Het
Crtac1 C T 19: 42,297,629 (GRCm39) probably null Het
Csmd3 T A 15: 47,445,923 (GRCm39) D3683V probably damaging Het
Ctrc A G 4: 141,572,354 (GRCm39) L62P probably damaging Het
Cyp3a57 A T 5: 145,307,867 (GRCm39) K208* probably null Het
Dnaaf2 A T 12: 69,244,122 (GRCm39) L313Q probably damaging Het
Dtl A G 1: 191,278,680 (GRCm39) L394P probably benign Het
Ehhadh T C 16: 21,585,305 (GRCm39) E192G probably benign Het
Fads2 T C 19: 10,059,997 (GRCm39) I226V probably benign Het
Fat2 T C 11: 55,161,208 (GRCm39) E3174G probably damaging Het
Galnt14 C T 17: 73,881,826 (GRCm39) R91Q probably damaging Het
Hdhd5 G T 6: 120,487,252 (GRCm39) D368E probably benign Het
Hk3 T A 13: 55,158,617 (GRCm39) I528F probably damaging Het
Il10ra A C 9: 45,166,951 (GRCm39) S533R possibly damaging Het
Itpr3 G T 17: 27,305,950 (GRCm39) K169N probably benign Het
Lrrc17 A G 5: 21,780,264 (GRCm39) T413A probably benign Het
Mcm2 C T 6: 88,861,053 (GRCm39) D882N probably benign Het
Met T C 6: 17,562,197 (GRCm39) V1186A probably damaging Het
Msh5 C T 17: 35,248,628 (GRCm39) probably null Het
Nav3 T C 10: 109,600,648 (GRCm39) I1326M probably damaging Het
Nek10 A G 14: 14,850,896 (GRCm38) I314V probably benign Het
Or10g1 A C 14: 52,648,225 (GRCm39) F35V probably damaging Het
Or8b53 T A 9: 38,667,412 (GRCm39) Y143N probably benign Het
Pim1 A G 17: 29,712,720 (GRCm39) E211G probably damaging Het
Plaat1 T A 16: 29,039,189 (GRCm39) Y90N probably benign Het
Ppp1r12b A T 1: 134,704,144 (GRCm39) D903E probably benign Het
Ptpn14 T C 1: 189,583,229 (GRCm39) L692P probably benign Het
Ptprt A G 2: 161,977,138 (GRCm39) C387R probably damaging Het
Qrfprl A G 6: 65,418,369 (GRCm39) probably benign Het
Shisa6 T A 11: 66,108,800 (GRCm39) D359V probably damaging Het
Shprh T C 10: 11,063,817 (GRCm39) S1297P probably damaging Het
Sik1 T C 17: 32,069,125 (GRCm39) D250G probably damaging Het
Slamf7 A G 1: 171,466,635 (GRCm39) L190S probably damaging Het
Slc22a3 G A 17: 12,652,355 (GRCm39) P423L probably damaging Het
Slc35e2 A T 4: 155,697,137 (GRCm39) E217V probably damaging Het
Spocd1 A T 4: 129,850,254 (GRCm39) N760I probably damaging Het
Tas2r136 G T 6: 132,754,294 (GRCm39) P278T possibly damaging Het
Tchhl1 A T 3: 93,377,836 (GRCm39) Q180L probably benign Het
Tmem151b T A 17: 45,858,010 (GRCm39) T79S probably benign Het
Tomm70a T A 16: 56,965,105 (GRCm39) C430S probably benign Het
Trbv16 T A 6: 41,128,936 (GRCm39) L40Q probably damaging Het
Trmt1l T G 1: 151,316,594 (GRCm39) I32S probably damaging Het
Ubr4 A G 4: 139,152,641 (GRCm39) T2011A probably damaging Het
Urb1 C T 16: 90,569,652 (GRCm39) W1358* probably null Het
Usp31 T G 7: 121,248,698 (GRCm39) H915P probably benign Het
Vmn2r10 A T 5: 109,151,377 (GRCm39) M79K possibly damaging Het
Vmn2r14 A G 5: 109,369,222 (GRCm39) I117T probably benign Het
Vps13b A G 15: 35,869,497 (GRCm39) H2667R possibly damaging Het
Vwa5b1 G A 4: 138,305,962 (GRCm39) T912M possibly damaging Het
Zfp709 G A 8: 72,643,363 (GRCm39) C264Y probably benign Het
Zkscan5 A G 5: 145,156,898 (GRCm39) I467V probably benign Het
Zxdc A T 6: 90,347,281 (GRCm39) D214V probably damaging Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125,366,766 (GRCm39) missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125,371,163 (GRCm39) missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125,358,164 (GRCm39) splice site probably null
R0317:Scarb1 UTSW 5 125,366,756 (GRCm39) missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125,366,745 (GRCm39) missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125,375,795 (GRCm39) unclassified probably benign
R0655:Scarb1 UTSW 5 125,377,504 (GRCm39) missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125,374,278 (GRCm39) unclassified probably benign
R2074:Scarb1 UTSW 5 125,371,207 (GRCm39) missense probably benign
R2267:Scarb1 UTSW 5 125,364,439 (GRCm39) missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125,364,475 (GRCm39) missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125,354,859 (GRCm39) missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125,377,409 (GRCm39) missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125,374,363 (GRCm39) missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125,377,451 (GRCm39) missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125,381,286 (GRCm39) missense probably damaging 0.98
R5883:Scarb1 UTSW 5 125,417,971 (GRCm39) unclassified probably benign
R6321:Scarb1 UTSW 5 125,381,395 (GRCm39) missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125,381,389 (GRCm39) missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125,381,394 (GRCm39) missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125,361,783 (GRCm39) missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125,374,294 (GRCm39) missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125,381,414 (GRCm39) missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125,361,089 (GRCm39) missense probably benign
R7830:Scarb1 UTSW 5 125,364,447 (GRCm39) missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125,371,103 (GRCm39) missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125,380,201 (GRCm39) missense probably benign 0.01
R8467:Scarb1 UTSW 5 125,375,731 (GRCm39) missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125,371,227 (GRCm39) missense probably damaging 1.00
R8814:Scarb1 UTSW 5 125,371,156 (GRCm39) missense probably benign 0.00
R9025:Scarb1 UTSW 5 125,381,414 (GRCm39) missense probably damaging 0.98
R9169:Scarb1 UTSW 5 125,371,146 (GRCm39) missense probably damaging 1.00
R9462:Scarb1 UTSW 5 125,417,891 (GRCm39) missense probably damaging 1.00
R9685:Scarb1 UTSW 5 125,371,194 (GRCm39) missense possibly damaging 0.49
R9699:Scarb1 UTSW 5 125,374,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGTGTGGCTGACAGTC -3'
(R):5'- CTTCCAGATGAGCCTTGGAG -3'

Sequencing Primer
(F):5'- GACTTCTGTCTCTGGAGCAATCAATC -3'
(R):5'- GAGGGTCCATGGCGCAG -3'
Posted On 2017-02-10