Incidental Mutation 'R5872:Met'
ID455242
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5872 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17562198 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1186 (V1186A)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: V1186A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: V1186A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: V1186A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: V1186A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: V1186A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: V1186A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTACTACTTAACAAATAGCTGTGGC -3'
(R):5'- CCAGGGGCTTACAGATTCACTC -3'

Sequencing Primer
(F):5'- TGCAGTGTTCTGAGCTCA -3'
(R):5'- ACAGATTCACTCAAAATAATCAGGG -3'
Posted On2017-02-10