Mutagenetix > Incidental Mutation

Incidental Mutation 'R5872:Shprh'

455259

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

044079-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5872 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11188073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1297 (S1297P)

Ref Sequence

ENSEMBL: ENSMUSP00000132870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]

AlphaFold

Q7TPQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000044053
AA Change: S1297P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: S1297P

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000054814
AA Change: S1297P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: S1297P

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159541
AA Change: S1297P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: S1297P

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159553

Predicted Effect

probably benign
Transcript: ENSMUST00000159810

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,660,352	S1219P	possibly damaging	Het
A2ml1	A	G	6: 128,561,526	Y644H	probably damaging	Het
Abca9	T	G	11: 110,117,076	R1232S	possibly damaging	Het
Acsf2	C	T	11: 94,573,149	V70M	probably benign	Het
Ampd1	A	G	3: 103,079,130	I42V	probably benign	Het
Arhgap10	A	G	8: 77,344,638		probably null	Het
Atp1a4	A	T	1: 172,244,408	L432Q	probably damaging	Het
Bbs12	T	A	3: 37,320,449	C349S	possibly damaging	Het
Bnc2	A	G	4: 84,292,770	V479A	possibly damaging	Het
C130060K24Rik	A	G	6: 65,441,385		probably benign	Het
Cald1	A	T	6: 34,771,108	K761*	probably null	Het
Cd177	C	T	7: 24,752,263	G443R	probably null	Het
Cdc42bpb	T	C	12: 111,325,976	D375G	probably damaging	Het
Chsy3	T	C	18: 59,176,196	Y174H	probably damaging	Het
Cmya5	T	C	13: 93,097,435	M382V	probably benign	Het
Col1a2	G	A	6: 4,531,926	S782N	unknown	Het
Crtac1	C	T	19: 42,309,190		probably null	Het
Csmd3	T	A	15: 47,582,527	D3683V	probably damaging	Het
Ctrc	A	G	4: 141,845,043	L62P	probably damaging	Het
Cyp3a57	A	T	5: 145,371,057	K208*	probably null	Het
Dnaaf2	A	T	12: 69,197,348	L313Q	probably damaging	Het
Dtl	A	G	1: 191,546,568	L394P	probably benign	Het
Ehhadh	T	C	16: 21,766,555	E192G	probably benign	Het
Fads2	T	C	19: 10,082,633	I226V	probably benign	Het
Fat2	T	C	11: 55,270,382	E3174G	probably damaging	Het
Galnt14	C	T	17: 73,574,831	R91Q	probably damaging	Het
Hdhd5	G	T	6: 120,510,291	D368E	probably benign	Het
Hk3	T	A	13: 55,010,804	I528F	probably damaging	Het
Hrasls	T	A	16: 29,220,437	Y90N	probably benign	Het
Il10ra	A	C	9: 45,255,653	S533R	possibly damaging	Het
Itpr3	G	T	17: 27,086,976	K169N	probably benign	Het
Lrrc17	A	G	5: 21,575,266	T413A	probably benign	Het
Mcm2	C	T	6: 88,884,071	D882N	probably benign	Het
Met	T	C	6: 17,562,198	V1186A	probably damaging	Het
Msh5	C	T	17: 35,029,652		probably null	Het
Nav3	T	C	10: 109,764,787	I1326M	probably damaging	Het
Nek10	A	G	14: 14,850,896	I314V	probably benign	Het
Olfr1510	A	C	14: 52,410,768	F35V	probably damaging	Het
Olfr920	T	A	9: 38,756,116	Y143N	probably benign	Het
Pim1	A	G	17: 29,493,746	E211G	probably damaging	Het
Ppp1r12b	A	T	1: 134,776,406	D903E	probably benign	Het
Ptpn14	T	C	1: 189,851,032	L692P	probably benign	Het
Ptprt	A	G	2: 162,135,218	C387R	probably damaging	Het
Scarb1	A	G	5: 125,304,277	Y68H	possibly damaging	Het
Shisa6	T	A	11: 66,217,974	D359V	probably damaging	Het
Sik1	T	C	17: 31,850,151	D250G	probably damaging	Het
Slamf7	A	G	1: 171,639,067	L190S	probably damaging	Het
Slc22a3	G	A	17: 12,433,468	P423L	probably damaging	Het
Slc35e2	A	T	4: 155,612,680	E217V	probably damaging	Het
Spocd1	A	T	4: 129,956,461	N760I	probably damaging	Het
Tas2r136	G	T	6: 132,777,331	P278T	possibly damaging	Het
Tchhl1	A	T	3: 93,470,529	Q180L	probably benign	Het
Tmem151b	T	A	17: 45,547,084	T79S	probably benign	Het
Tomm70a	T	A	16: 57,144,742	C430S	probably benign	Het
Trbv16	T	A	6: 41,152,002	L40Q	probably damaging	Het
Trmt1l	T	G	1: 151,440,843	I32S	probably damaging	Het
Ubr4	A	G	4: 139,425,330	T2011A	probably damaging	Het
Urb1	C	T	16: 90,772,764	W1358*	probably null	Het
Usp31	T	G	7: 121,649,475	H915P	probably benign	Het
Vmn2r10	A	T	5: 109,003,511	M79K	possibly damaging	Het
Vmn2r14	A	G	5: 109,221,356	I117T	probably benign	Het
Vps13b	A	G	15: 35,869,351	H2667R	possibly damaging	Het
Vwa5b1	G	A	4: 138,578,651	T912M	possibly damaging	Het
Zfp709	G	A	8: 71,889,519	C264Y	probably benign	Het
Zkscan5	A	G	5: 145,220,088	I467V	probably benign	Het
Zxdc	A	T	6: 90,370,299	D214V	probably damaging	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0325:Shprh	UTSW	10	11170109	missense	probably benign	0.00
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1263:Shprh	UTSW	10	11159530	missense	probably damaging	1.00
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1638:Shprh	UTSW	10	11157078	missense	probably benign
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	splice site	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7158:Shprh	UTSW	10	11166730	missense	probably damaging	0.98
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
R8082:Shprh	UTSW	10	11151811	missense	probably benign	0.22
R8116:Shprh	UTSW	10	11213461	missense	probably damaging	0.99
R8390:Shprh	UTSW	10	11187983	missense	possibly damaging	0.92
R8445:Shprh	UTSW	10	11181569	missense	possibly damaging	0.92
R8530:Shprh	UTSW	10	11151934	missense	probably benign	0.37
R8759:Shprh	UTSW	10	11157164	missense	possibly damaging	0.92
R8937:Shprh	UTSW	10	11185437	missense	possibly damaging	0.60
R8995:Shprh	UTSW	10	11164830	nonsense	probably null
R9053:Shprh	UTSW	10	11154702	missense	probably benign	0.04
R9131:Shprh	UTSW	10	11162845	missense	possibly damaging	0.58
R9176:Shprh	UTSW	10	11160576	missense	probably benign	0.02
R9391:Shprh	UTSW	10	11162889	missense	probably benign	0.05
R9423:Shprh	UTSW	10	11205263	missense	probably damaging	1.00
R9563:Shprh	UTSW	10	11166491	nonsense	probably null
R9668:Shprh	UTSW	10	11206332	missense	probably damaging	0.97
R9709:Shprh	UTSW	10	11162830	missense	possibly damaging	0.91
R9718:Shprh	UTSW	10	11213504	missense	probably damaging	1.00
R9750:Shprh	UTSW	10	11164460	missense	probably damaging	0.98
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCGCTCATTTGCAGTGCTAG -3'
(R):5'- CAGCTGTTAAGAATAAGCAGCTTAC -3'

Sequencing Primer
(F):5'- AGGCCAGACTGCAATCTT -3'
(R):5'- ACATTTTAACTGCAAGTGTCAGC -3'

Posted On

2017-02-10