Incidental Mutation 'R5872:Acsf2'
ID 455263
Institutional Source Beutler Lab
Gene Symbol Acsf2
Ensembl Gene ENSMUSG00000076435
Gene Name acyl-CoA synthetase family member 2
Synonyms
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5872 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 94557102-94601871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94573149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 70 (V70M)
Ref Sequence ENSEMBL: ENSMUSP00000099453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040418] [ENSMUST00000103164]
AlphaFold Q8VCW8
Predicted Effect probably benign
Transcript: ENSMUST00000040418
SMART Domains Protein: ENSMUSP00000047844
Gene: ENSMUSG00000039084

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 21 54 1.7e-7 SMART
LRR_TYP 73 96 9.58e-3 SMART
LRR_TYP 97 120 1.45e-2 SMART
LRR_TYP 121 144 1.69e-3 SMART
LRR_TYP 145 168 6.42e-4 SMART
LRR 170 192 2.2e1 SMART
LRR 193 216 2.14e1 SMART
LRR_TYP 217 240 4.17e-3 SMART
LRR 245 265 2.27e2 SMART
LRR 266 289 3.36e1 SMART
LRRCT 299 346 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103164
AA Change: V70M

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435
AA Change: V70M

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155122
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Acsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Acsf2 APN 11 94570450 missense probably benign 0.00
IGL02218:Acsf2 APN 11 94601763 missense probably benign 0.00
IGL02602:Acsf2 APN 11 94570465 splice site probably benign
Citrus UTSW 11 94571650 missense probably benign 0.11
Cocktail UTSW 11 94570385 missense probably benign 0.06
limonene UTSW 11 94562888 missense probably damaging 0.99
R0047:Acsf2 UTSW 11 94569342 missense probably benign 0.01
R0194:Acsf2 UTSW 11 94561370 missense probably benign 0.00
R1400:Acsf2 UTSW 11 94570316 missense probably benign 0.07
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1512:Acsf2 UTSW 11 94561398 splice site probably benign
R2007:Acsf2 UTSW 11 94571640 missense possibly damaging 0.88
R2271:Acsf2 UTSW 11 94558873 nonsense probably null
R3610:Acsf2 UTSW 11 94561346 missense probably benign 0.00
R4447:Acsf2 UTSW 11 94569359 missense possibly damaging 0.68
R4717:Acsf2 UTSW 11 94559546 missense probably benign 0.02
R4857:Acsf2 UTSW 11 94569338 missense probably benign 0.07
R4974:Acsf2 UTSW 11 94569329 missense possibly damaging 0.77
R5090:Acsf2 UTSW 11 94571269 critical splice donor site probably null
R5185:Acsf2 UTSW 11 94562911 missense probably damaging 1.00
R5732:Acsf2 UTSW 11 94569942 unclassified probably benign
R5797:Acsf2 UTSW 11 94571679 missense probably damaging 0.98
R6350:Acsf2 UTSW 11 94558330 missense probably benign 0.12
R6903:Acsf2 UTSW 11 94559591 missense probably benign 0.03
R6912:Acsf2 UTSW 11 94570380 missense probably benign
R7336:Acsf2 UTSW 11 94571650 missense probably benign 0.11
R7531:Acsf2 UTSW 11 94573231 splice site probably null
R8026:Acsf2 UTSW 11 94562888 missense probably damaging 0.99
R8231:Acsf2 UTSW 11 94561362 missense probably benign 0.01
R8355:Acsf2 UTSW 11 94570624 missense probably benign 0.00
R8486:Acsf2 UTSW 11 94569960 missense probably damaging 0.98
R8525:Acsf2 UTSW 11 94572620 missense probably benign 0.21
R8956:Acsf2 UTSW 11 94570385 missense probably benign 0.06
R9288:Acsf2 UTSW 11 94573218 missense probably benign 0.04
R9481:Acsf2 UTSW 11 94573218 missense probably benign 0.04
R9564:Acsf2 UTSW 11 94573065 missense possibly damaging 0.88
R9620:Acsf2 UTSW 11 94572586 nonsense probably null
R9671:Acsf2 UTSW 11 94569976 missense probably benign 0.27
R9742:Acsf2 UTSW 11 94573137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTTTCCTAATGCCCACAGC -3'
(R):5'- CTGTCAGTACTCAACATACCAATG -3'

Sequencing Primer
(F):5'- GGGAGTCCCTTTCACACTG -3'
(R):5'- AGCTAAGTGTGCCAGAGT -3'
Posted On 2017-02-10