Incidental Mutation 'R5872:Abca9'
ID455264
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission 044079-MU
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5872 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110117076 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1232 (R1232S)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044850
AA Change: R1232S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: R1232S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6675:Abca9 UTSW 11 110115476 missense probably benign
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
R7390:Abca9 UTSW 11 110145661 missense probably benign 0.01
R7429:Abca9 UTSW 11 110127426 frame shift probably null
R7431:Abca9 UTSW 11 110127426 frame shift probably null
R7621:Abca9 UTSW 11 110160533 missense probably benign 0.00
R7623:Abca9 UTSW 11 110107558 missense probably benign 0.27
R7660:Abca9 UTSW 11 110115452 missense probably benign
R7784:Abca9 UTSW 11 110154417 nonsense probably null
R7798:Abca9 UTSW 11 110138179 missense probably benign 0.45
R7839:Abca9 UTSW 11 110134259 missense probably benign 0.43
R7891:Abca9 UTSW 11 110163272 missense probably benign 0.03
R7894:Abca9 UTSW 11 110106589 missense possibly damaging 0.49
R8030:Abca9 UTSW 11 110120708 missense probably benign
R8133:Abca9 UTSW 11 110127463 missense possibly damaging 0.88
R8195:Abca9 UTSW 11 110138329 missense probably benign 0.01
R8304:Abca9 UTSW 11 110107128 critical splice donor site probably null
R8386:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R8390:Abca9 UTSW 11 110145630 missense probably benign 0.01
R8692:Abca9 UTSW 11 110141583 missense probably benign 0.11
R8721:Abca9 UTSW 11 110144289 missense possibly damaging 0.82
R8738:Abca9 UTSW 11 110165991 start codon destroyed probably null 1.00
R8900:Abca9 UTSW 11 110154392 missense probably benign
R8948:Abca9 UTSW 11 110163380 critical splice acceptor site probably null
R8950:Abca9 UTSW 11 110163380 critical splice acceptor site probably null
Z1176:Abca9 UTSW 11 110135375 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGCCAGTAGAATTCCTTCTC -3'
(R):5'- GCAATTTTGTAGATGGTCAGTCTC -3'

Sequencing Primer
(F):5'- GACGTCTTATGTACACTAATGTTGC -3'
(R):5'- GGTCAGTCTCATTAAATTAACTTC -3'
Posted On2017-02-10