Incidental Mutation 'R5873:Mybl1'
ID 455286
Institutional Source Beutler Lab
Gene Symbol Mybl1
Ensembl Gene ENSMUSG00000025912
Gene Name myeloblastosis oncogene-like 1
Synonyms G1-419-6, A-myb, repro9
MMRRC Submission 044080-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.622) question?
Stock # R5873 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 9737640-9770434 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9755890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 220 (T220S)
Ref Sequence ENSEMBL: ENSMUSP00000086034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088658] [ENSMUST00000115468]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000088658
AA Change: T220S

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086034
Gene: ENSMUSG00000025912
AA Change: T220S

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 240 285 1.2e-29 PFAM
Pfam:Cmyb_C 485 648 6.9e-82 PFAM
low complexity region 734 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115468
AA Change: T220S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111128
Gene: ENSMUSG00000025912
AA Change: T220S

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 239 285 1.9e-30 PFAM
Pfam:Cmyb_C 485 651 4.1e-74 PFAM
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160451
Predicted Effect unknown
Transcript: ENSMUST00000188212
AA Change: T224S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes show growth retardation after birth and an impairment of serum antibody response. Male mutant mice are sterile due to a meiotic defect. While female mutant mice are fertile, breast development is impaired after pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 (GRCm39) probably null Het
4930505A04Rik T A 11: 30,376,220 (GRCm39) K216* probably null Het
5330417H12Rik T C 7: 107,223,975 (GRCm39) probably benign Het
Abcc4 G T 14: 118,763,702 (GRCm39) D1044E probably benign Het
Adgre4 A G 17: 56,159,282 (GRCm39) T656A probably benign Het
Ankk1 T C 9: 49,327,196 (GRCm39) N661S probably benign Het
Asah2 A G 19: 31,981,082 (GRCm39) probably null Het
Asxl3 A G 18: 22,649,142 (GRCm39) D377G probably benign Het
C3ar1 A G 6: 122,827,381 (GRCm39) S279P probably benign Het
C7 A G 15: 5,034,717 (GRCm39) V610A probably damaging Het
Cacna2d3 C A 14: 29,442,891 (GRCm39) A48S probably benign Het
Card11 T A 5: 140,894,393 (GRCm39) I79F probably damaging Het
Casc3 A G 11: 98,712,270 (GRCm39) Y103C unknown Het
Cass4 G T 2: 172,268,688 (GRCm39) V259L probably benign Het
Col14a1 A G 15: 55,309,182 (GRCm39) probably benign Het
Cox10 A G 11: 63,962,512 (GRCm39) S110P probably benign Het
Cpt1b T C 15: 89,304,931 (GRCm39) Y439C probably damaging Het
Crybb2 C T 5: 113,213,759 (GRCm39) probably null Het
Cyp2b23 C T 7: 26,374,431 (GRCm39) R271H probably benign Het
Dnah17 T C 11: 117,947,723 (GRCm39) I3039V probably benign Het
Dnpep T C 1: 75,291,787 (GRCm39) D242G probably damaging Het
Dock10 T A 1: 80,551,855 (GRCm39) N660I probably damaging Het
Esco2 T C 14: 66,061,640 (GRCm39) D471G probably benign Het
Evpl A T 11: 116,125,258 (GRCm39) L97H probably damaging Het
Exoc3l4 A T 12: 111,389,850 (GRCm39) I142F probably damaging Het
Fry C A 5: 150,302,350 (GRCm39) P519Q probably damaging Het
Gal3st2 T A 1: 93,801,472 (GRCm39) F92I probably benign Het
Galm A G 17: 80,445,532 (GRCm39) E94G probably benign Het
Gfy T G 7: 44,827,004 (GRCm39) H364P probably damaging Het
Helz2 A G 2: 180,875,821 (GRCm39) S1558P possibly damaging Het
Hmmr T A 11: 40,598,527 (GRCm39) Q600L probably damaging Het
Hnrnph3 A G 10: 62,855,170 (GRCm39) probably null Het
Igkv4-90 T A 6: 68,784,453 (GRCm39) N21I probably benign Het
Kpna1 A G 16: 35,834,598 (GRCm39) probably benign Het
Krt28 A C 11: 99,257,716 (GRCm39) L375R probably damaging Het
Lrrn1 T C 6: 107,545,936 (GRCm39) V578A probably damaging Het
Lta4h T C 10: 93,305,052 (GRCm39) probably null Het
Matk T A 10: 81,095,963 (GRCm39) V166E probably benign Het
Muc4 C A 16: 32,570,113 (GRCm39) T391K possibly damaging Het
Nrp1 T C 8: 129,194,858 (GRCm39) V438A probably damaging Het
Or2y6 A T 11: 52,104,180 (GRCm39) L212Q probably damaging Het
Or6p1 T A 1: 174,258,348 (GRCm39) M118K possibly damaging Het
Pdia4 A T 6: 47,785,110 (GRCm39) W86R probably damaging Het
Pdzd7 T A 19: 45,016,388 (GRCm39) D911V probably damaging Het
Pkd1 A G 17: 24,788,804 (GRCm39) Q854R probably benign Het
Ppl A G 16: 4,923,913 (GRCm39) probably null Het
Ppp1r26 A G 2: 28,341,617 (GRCm39) T416A probably benign Het
Prdm15 T C 16: 97,609,889 (GRCm39) D585G probably damaging Het
Rbak A G 5: 143,159,466 (GRCm39) V529A probably benign Het
Rc3h1 C T 1: 160,787,071 (GRCm39) T822I probably damaging Het
Slc25a18 A T 6: 120,763,242 (GRCm39) probably null Het
Taf2 T C 15: 54,901,818 (GRCm39) N792S probably benign Het
Tat T C 8: 110,718,581 (GRCm39) probably null Het
Tbx21 A T 11: 97,005,474 (GRCm39) probably null Het
Txndc11 A G 16: 10,893,069 (GRCm39) L887P probably damaging Het
Usp10 A G 8: 120,673,831 (GRCm39) T399A possibly damaging Het
Vmn2r26 A T 6: 124,038,633 (GRCm39) H736L probably benign Het
Vstm2a T A 11: 16,208,044 (GRCm39) F13I probably damaging Het
Zkscan5 A G 5: 145,157,204 (GRCm39) R496G possibly damaging Het
Zranb2 C T 3: 157,242,020 (GRCm39) R36* probably null Het
Other mutations in Mybl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Mybl1 APN 1 9,741,904 (GRCm39) missense probably damaging 1.00
IGL01431:Mybl1 APN 1 9,742,872 (GRCm39) missense probably damaging 0.97
IGL01733:Mybl1 APN 1 9,755,935 (GRCm39) missense possibly damaging 0.94
IGL01903:Mybl1 APN 1 9,741,801 (GRCm39) splice site probably null
IGL02527:Mybl1 APN 1 9,760,373 (GRCm39) missense probably damaging 0.99
IGL02729:Mybl1 APN 1 9,742,795 (GRCm39) missense probably benign 0.22
IGL02810:Mybl1 APN 1 9,748,613 (GRCm39) missense probably benign
IGL02810:Mybl1 APN 1 9,743,340 (GRCm39) missense probably damaging 1.00
IGL03369:Mybl1 APN 1 9,742,780 (GRCm39) missense probably damaging 0.99
R0696:Mybl1 UTSW 1 9,743,373 (GRCm39) missense probably damaging 1.00
R1453:Mybl1 UTSW 1 9,741,901 (GRCm39) missense probably benign 0.27
R1476:Mybl1 UTSW 1 9,742,886 (GRCm39) splice site probably null
R1567:Mybl1 UTSW 1 9,755,976 (GRCm39) missense probably damaging 1.00
R3110:Mybl1 UTSW 1 9,752,095 (GRCm39) missense probably damaging 1.00
R3112:Mybl1 UTSW 1 9,752,095 (GRCm39) missense probably damaging 1.00
R3438:Mybl1 UTSW 1 9,757,870 (GRCm39) missense probably damaging 1.00
R3801:Mybl1 UTSW 1 9,743,439 (GRCm39) missense probably damaging 1.00
R4333:Mybl1 UTSW 1 9,742,523 (GRCm39) missense probably damaging 1.00
R4646:Mybl1 UTSW 1 9,742,511 (GRCm39) missense probably damaging 1.00
R4705:Mybl1 UTSW 1 9,760,340 (GRCm39) missense probably damaging 0.99
R6326:Mybl1 UTSW 1 9,748,732 (GRCm39) critical splice acceptor site probably null
R6444:Mybl1 UTSW 1 9,755,917 (GRCm39) missense possibly damaging 0.93
R6801:Mybl1 UTSW 1 9,753,353 (GRCm39) missense probably benign 0.42
R7168:Mybl1 UTSW 1 9,748,513 (GRCm39) missense probably damaging 1.00
R8322:Mybl1 UTSW 1 9,746,506 (GRCm39) missense probably damaging 1.00
R9369:Mybl1 UTSW 1 9,742,829 (GRCm39) missense probably damaging 1.00
R9459:Mybl1 UTSW 1 9,746,484 (GRCm39) missense possibly damaging 0.86
Z1176:Mybl1 UTSW 1 9,755,994 (GRCm39) missense probably damaging 0.99
Z1177:Mybl1 UTSW 1 9,746,265 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACGCACTATATTTCTCAATGTGG -3'
(R):5'- TAACCTCGGTGACACAAGGG -3'

Sequencing Primer
(F):5'- AGGAAACTTTCAAGTGAAATTTGTAC -3'
(R):5'- CAGAGCGGTCTTCATCAA -3'
Posted On 2017-02-10