Incidental Mutation 'R5873:Olfr414'
ID455293
Institutional Source Beutler Lab
Gene Symbol Olfr414
Ensembl Gene ENSMUSG00000051509
Gene Nameolfactory receptor 414
SynonymsGA_x6K02T2P20D-20749615-20748662, MOR103-10
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5873 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174424064-174434747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174430782 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000142051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053178] [ENSMUST00000192358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053178
AA Change: M118K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052426
Gene: ENSMUSG00000051509
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-53 PFAM
Pfam:7tm_1 41 290 8.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192358
AA Change: M118K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142051
Gene: ENSMUSG00000051509
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.9e-29 PFAM
Pfam:7tm_4 139 283 1.1e-45 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Olfr414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Olfr414 APN 1 174431342 missense probably benign 0.00
IGL01560:Olfr414 APN 1 174430901 missense probably benign 0.17
IGL01795:Olfr414 APN 1 174430649 missense possibly damaging 0.83
IGL03286:Olfr414 APN 1 174431177 missense probably benign 0.01
PIT4131001:Olfr414 UTSW 1 174430824 missense probably damaging 1.00
R0219:Olfr414 UTSW 1 174430466 missense probably benign 0.00
R0492:Olfr414 UTSW 1 174430563 missense possibly damaging 0.95
R1052:Olfr414 UTSW 1 174431135 nonsense probably null
R1054:Olfr414 UTSW 1 174430853 missense probably benign 0.36
R1473:Olfr414 UTSW 1 174430643 missense probably damaging 0.97
R1675:Olfr414 UTSW 1 174431097 missense probably benign
R1774:Olfr414 UTSW 1 174431339 missense probably benign 0.00
R1861:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R1959:Olfr414 UTSW 1 174430905 missense probably damaging 1.00
R1978:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R4043:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R5020:Olfr414 UTSW 1 174430671 missense probably damaging 0.98
R5354:Olfr414 UTSW 1 174430686 missense probably damaging 0.98
R6053:Olfr414 UTSW 1 174430569 nonsense probably null
Z1176:Olfr414 UTSW 1 174430591 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTCGACAATCTGGCTCACCC -3'
(R):5'- TGTCTGAACAAGTGAGGTTGAG -3'

Sequencing Primer
(F):5'- TCTGGCTCACCCCAAGC -3'
(R):5'- GTTGAGCAGTGGAGAAATATCAC -3'
Posted On2017-02-10