Incidental Mutation 'R5873:Vmn2r26'
ID 455309
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5873 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124061674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 736 (H736L)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: H736L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: H736L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGGCAAAGACCTTCATTGTG -3'
(R):5'- CCTTTCGAGCTCAGGTAAGC -3'

Sequencing Primer
(F):5'- CAAAGACCTTCATTGTGGTTATGGC -3'
(R):5'- TGCAGAAAACCAGCATGCTG -3'
Posted On 2017-02-10