Incidental Mutation 'R5873:Lta4h'
ID455321
Institutional Source Beutler Lab
Gene Symbol Lta4h
Ensembl Gene ENSMUSG00000015889
Gene Nameleukotriene A4 hydrolase
SynonymsLTA4 hydrodase
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5873 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93453411-93484875 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93469190 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016033]
Predicted Effect probably null
Transcript: ENSMUST00000016033
SMART Domains Protein: ENSMUSP00000016033
Gene: ENSMUSG00000015889

DomainStartEndE-ValueType
Pfam:Peptidase_M1 13 387 7.8e-80 PFAM
Leuk-A4-hydro_C 464 608 2.01e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216174
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have grossly normal phenotypes. Inflammatory reactions are reduced as are some other immunological responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Lta4h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Lta4h APN 10 93471370 splice site probably benign
IGL02309:Lta4h APN 10 93474490 missense probably damaging 1.00
IGL02351:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02358:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02589:Lta4h APN 10 93474931 missense probably benign 0.01
IGL02649:Lta4h APN 10 93472969 missense probably benign 0.00
IGL03164:Lta4h APN 10 93470797 splice site probably benign
R0498:Lta4h UTSW 10 93471971 splice site probably benign
R1451:Lta4h UTSW 10 93480728 missense probably damaging 0.99
R1690:Lta4h UTSW 10 93484692 missense probably benign
R1837:Lta4h UTSW 10 93469175 missense probably damaging 1.00
R4202:Lta4h UTSW 10 93470807 missense probably damaging 1.00
R4684:Lta4h UTSW 10 93468816 missense probably benign
R5528:Lta4h UTSW 10 93471874 missense probably damaging 1.00
R5637:Lta4h UTSW 10 93468869 splice site probably null
R6965:Lta4h UTSW 10 93471897 nonsense probably null
R7282:Lta4h UTSW 10 93453511 start codon destroyed probably null 0.98
R7779:Lta4h UTSW 10 93474949 missense probably benign 0.06
R8045:Lta4h UTSW 10 93469106 missense probably damaging 1.00
R8281:Lta4h UTSW 10 93453594 missense probably damaging 1.00
R8306:Lta4h UTSW 10 93482264 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACAGAAAGCCGTTTTGCAC -3'
(R):5'- AAGCTCTTCCCATCTGTGTATGTG -3'

Sequencing Primer
(F):5'- CAGAAAGCCGTTTTGCACTTTTAAG -3'
(R):5'- AGACAGTATCTCTCATTGGCCTGG -3'
Posted On2017-02-10