Incidental Mutation 'R5873:4930505A04Rik'
ID455323
Institutional Source Beutler Lab
Gene Symbol 4930505A04Rik
Ensembl Gene ENSMUSG00000040919
Gene NameRIKEN cDNA 4930505A04 gene
Synonyms
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5873 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30426006-30471827 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30426220 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 216 (K216*)
Ref Sequence ENSEMBL: ENSMUSP00000045288 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000041763
AA Change: K216*
Predicted Effect probably benign
Transcript: ENSMUST00000152718
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in 4930505A04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:4930505A04Rik APN 11 30454843 missense possibly damaging 0.69
IGL01545:4930505A04Rik APN 11 30426228 missense probably benign 0.13
R0400:4930505A04Rik UTSW 11 30426360 missense probably benign 0.09
R1029:4930505A04Rik UTSW 11 30426177 missense probably damaging 0.96
R1029:4930505A04Rik UTSW 11 30446389 splice site probably benign
R1585:4930505A04Rik UTSW 11 30427175 splice site probably benign
R4708:4930505A04Rik UTSW 11 30454717 missense probably damaging 0.98
R4993:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4994:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4995:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4996:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5187:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5189:4930505A04Rik UTSW 11 30426169 missense probably damaging 0.97
R5330:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5333:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5448:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5449:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5450:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5475:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5477:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5665:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5823:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5832:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5833:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5835:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6058:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6224:4930505A04Rik UTSW 11 30454815 missense probably benign 0.44
RF046:4930505A04Rik UTSW 11 30426249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGGTTTAAAGGCCCGTG -3'
(R):5'- GTTCCATCCCCAGAACTTGAAC -3'

Sequencing Primer
(F):5'- GCCTGGTGAGAAGAGCTTGC -3'
(R):5'- CCATACACTCAGCTACAGTTCTTG -3'
Posted On2017-02-10