Mutagenetix > Incidental Mutations

Incidental Mutation 'R5873:Casc3'

455328

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

044080-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R5873 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98821444 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 103 (Y103C)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]

Predicted Effect

unknown
Transcript: ENSMUST00000017384
AA Change: Y103C

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: Y103C

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147065

Predicted Effect

unknown
Transcript: ENSMUST00000169695
AA Change: Y103C

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: Y103C

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	A	18: 6,630,167		probably null	Het
4930505A04Rik	T	A	11: 30,426,220	K216*	probably null	Het
5330417H12Rik	T	C	7: 107,624,768		probably benign	Het
Abcc4	G	T	14: 118,526,290	D1044E	probably benign	Het
Adgre4	A	G	17: 55,852,282	T656A	probably benign	Het
Ankk1	T	C	9: 49,415,896	N661S	probably benign	Het
Asah2	A	G	19: 32,003,682		probably null	Het
Asxl3	A	G	18: 22,516,085	D377G	probably benign	Het
C3ar1	A	G	6: 122,850,422	S279P	probably benign	Het
C7	A	G	15: 5,005,235	V610A	probably damaging	Het
Cacna2d3	C	A	14: 29,720,934	A48S	probably benign	Het
Card11	T	A	5: 140,908,638	I79F	probably damaging	Het
Cass4	G	T	2: 172,426,768	V259L	probably benign	Het
Col14a1	A	G	15: 55,445,786		probably benign	Het
Cox10	A	G	11: 64,071,686	S110P	probably benign	Het
Cpt1b	T	C	15: 89,420,728	Y439C	probably damaging	Het
Crybb2	C	T	5: 113,065,893		probably null	Het
Cyp2b23	C	T	7: 26,675,006	R271H	probably benign	Het
Dnah17	T	C	11: 118,056,897	I3039V	probably benign	Het
Dnpep	T	C	1: 75,315,143	D242G	probably damaging	Het
Dock10	T	A	1: 80,574,138	N660I	probably damaging	Het
Esco2	T	C	14: 65,824,191	D471G	probably benign	Het
Evpl	A	T	11: 116,234,432	L97H	probably damaging	Het
Exoc3l4	A	T	12: 111,423,416	I142F	probably damaging	Het
Fry	C	A	5: 150,378,885	P519Q	probably damaging	Het
Gal3st2	T	A	1: 93,873,750	F92I	probably benign	Het
Galm	A	G	17: 80,138,103	E94G	probably benign	Het
Gfy	T	G	7: 45,177,580	H364P	probably damaging	Het
Helz2	A	G	2: 181,234,028	S1558P	possibly damaging	Het
Hmmr	T	A	11: 40,707,700	Q600L	probably damaging	Het
Hnrnph3	A	G	10: 63,019,391		probably null	Het
Igkv4-90	T	A	6: 68,807,469	N21I	probably benign	Het
Kpna1	A	G	16: 36,014,228		probably benign	Het
Krt28	A	C	11: 99,366,890	L375R	probably damaging	Het
Lrrn1	T	C	6: 107,568,975	V578A	probably damaging	Het
Lta4h	T	C	10: 93,469,190		probably null	Het
Matk	T	A	10: 81,260,129	V166E	probably benign	Het
Muc4	C	A	16: 32,751,295	T391K	possibly damaging	Het
Mybl1	T	A	1: 9,685,665	T220S	possibly damaging	Het
Nrp1	T	C	8: 128,468,377	V438A	probably damaging	Het
Olfr1371	A	T	11: 52,213,353	L212Q	probably damaging	Het
Olfr414	T	A	1: 174,430,782	M118K	possibly damaging	Het
Pdia4	A	T	6: 47,808,176	W86R	probably damaging	Het
Pdzd7	T	A	19: 45,027,949	D911V	probably damaging	Het
Pkd1	A	G	17: 24,569,830	Q854R	probably benign	Het
Ppl	A	G	16: 5,106,049		probably null	Het
Ppp1r26	A	G	2: 28,451,605	T416A	probably benign	Het
Prdm15	T	C	16: 97,808,689	D585G	probably damaging	Het
Rbak	A	G	5: 143,173,711	V529A	probably benign	Het
Rc3h1	C	T	1: 160,959,501	T822I	probably damaging	Het
Slc25a18	A	T	6: 120,786,281		probably null	Het
Taf2	T	C	15: 55,038,422	N792S	probably benign	Het
Tat	T	C	8: 109,991,949		probably null	Het
Tbx21	A	T	11: 97,114,648		probably null	Het
Txndc11	A	G	16: 11,075,205	L887P	probably damaging	Het
Usp10	A	G	8: 119,947,092	T399A	possibly damaging	Het
Vmn2r26	A	T	6: 124,061,674	H736L	probably benign	Het
Vstm2a	T	A	11: 16,258,044	F13I	probably damaging	Het
Zkscan5	A	G	5: 145,220,394	R496G	possibly damaging	Het
Zranb2	C	T	3: 157,536,383	R36*	probably null	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4380:Casc3	UTSW	11	98823031	missense	possibly damaging	0.67
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	intron	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R6041:Casc3	UTSW	11	98828559	missense	probably damaging	1.00
R6685:Casc3	UTSW	11	98822530	missense	probably damaging	0.99
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R7660:Casc3	UTSW	11	98809873	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCCTGCCTTTGAAATGCTTG -3'
(R):5'- CACATCCAGGGACTTGAGAG -3'

Sequencing Primer
(F):5'- GTATCTCCTATAGAACAGGCTGGC -3'
(R):5'- ACTTGAGAGGCCCTGTGC -3'

Posted On

2017-02-10