Incidental Mutation 'R5873:Casc3'
ID455328
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Namecancer susceptibility candidate 3
SynonymsBtz, Mln51
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5873 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98804905-98833814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98821444 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 103 (Y103C)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
Predicted Effect unknown
Transcript: ENSMUST00000017384
AA Change: Y103C
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: Y103C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147065
Predicted Effect unknown
Transcript: ENSMUST00000169695
AA Change: Y103C
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: Y103C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98823202 missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98823401 critical splice donor site probably null
IGL01901:Casc3 APN 11 98823121 missense probably damaging 1.00
IGL02345:Casc3 APN 11 98827564 splice site probably benign
IGL02875:Casc3 APN 11 98821552 missense probably damaging 1.00
IGL02964:Casc3 APN 11 98828923 missense probably damaging 0.96
R0147:Casc3 UTSW 11 98822499 missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98821493 missense probably damaging 0.99
R0763:Casc3 UTSW 11 98831318 missense probably damaging 1.00
R1581:Casc3 UTSW 11 98822818 missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98821506 missense probably benign 0.01
R4380:Casc3 UTSW 11 98823031 missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98822958 missense probably benign 0.13
R4988:Casc3 UTSW 11 98821874 intron probably null
R5079:Casc3 UTSW 11 98810426 intron probably benign
R5442:Casc3 UTSW 11 98821471 missense probably damaging 0.99
R5511:Casc3 UTSW 11 98810914 nonsense probably null
R6041:Casc3 UTSW 11 98828559 missense probably damaging 1.00
R6685:Casc3 UTSW 11 98822530 missense probably damaging 0.99
R7030:Casc3 UTSW 11 98822533 missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98827587 missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98821485 missense probably benign 0.04
R7659:Casc3 UTSW 11 98809873 missense unknown
R7660:Casc3 UTSW 11 98809873 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCTGCCTTTGAAATGCTTG -3'
(R):5'- CACATCCAGGGACTTGAGAG -3'

Sequencing Primer
(F):5'- GTATCTCCTATAGAACAGGCTGGC -3'
(R):5'- ACTTGAGAGGCCCTGTGC -3'
Posted On2017-02-10