Incidental Mutation 'R5873:Krt28'
ID 455329
Institutional Source Beutler Lab
Gene Symbol Krt28
Ensembl Gene ENSMUSG00000055937
Gene Name keratin 28
Synonyms
MMRRC Submission 044080-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5873 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 99364872-99374903 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 99366890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 375 (L375R)
Ref Sequence ENSEMBL: ENSMUSP00000006963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006963]
AlphaFold A6BLY7
Predicted Effect probably damaging
Transcript: ENSMUST00000006963
AA Change: L375R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006963
Gene: ENSMUSG00000055937
AA Change: L375R

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Filament 83 398 4.6e-144 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Krt28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Krt28 APN 11 99371468 missense probably benign 0.00
IGL01568:Krt28 APN 11 99371417 missense probably damaging 1.00
IGL01590:Krt28 APN 11 99374394 critical splice donor site probably null
R1250:Krt28 UTSW 11 99366822 critical splice donor site probably null
R1488:Krt28 UTSW 11 99365171 missense probably benign 0.01
R2116:Krt28 UTSW 11 99365117 missense probably benign 0.27
R4244:Krt28 UTSW 11 99374550 missense probably damaging 1.00
R4862:Krt28 UTSW 11 99365110 missense possibly damaging 0.92
R4928:Krt28 UTSW 11 99374632 missense probably benign 0.00
R5035:Krt28 UTSW 11 99366824 missense probably benign 0.00
R5568:Krt28 UTSW 11 99371384 missense probably damaging 1.00
R5642:Krt28 UTSW 11 99374494 missense probably damaging 1.00
R6053:Krt28 UTSW 11 99371201 missense probably benign 0.05
R6548:Krt28 UTSW 11 99367013 missense probably damaging 1.00
R7194:Krt28 UTSW 11 99374404 nonsense probably null
R7863:Krt28 UTSW 11 99365173 missense possibly damaging 0.65
R7986:Krt28 UTSW 11 99366825 missense probably benign 0.00
R8415:Krt28 UTSW 11 99374800 missense probably benign
R9710:Krt28 UTSW 11 99365095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCCCTCTATTTAGAAGCAGG -3'
(R):5'- TGGGTACTCCTCTGGTGACTTC -3'

Sequencing Primer
(F):5'- TCCCTCTATTTAGAAGCAGGAGAAG -3'
(R):5'- GGTGACTTCATCCCTTACTATGATC -3'
Posted On 2017-02-10