Incidental Mutation 'R5873:Esco2'
ID455335
Institutional Source Beutler Lab
Gene Symbol Esco2
Ensembl Gene ENSMUSG00000022034
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5873 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65819038-65833994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65824191 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 471 (D471G)
Ref Sequence ENSEMBL: ENSMUSP00000022613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022613]
Predicted Effect probably benign
Transcript: ENSMUST00000022613
AA Change: D471G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034
AA Change: D471G

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224162
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation associated with impaired chromosome cohesion and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
Asxl3 A G 18: 22,516,085 D377G probably benign Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Esco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Esco2 APN 14 65826528 missense probably benign 0.00
IGL01613:Esco2 APN 14 65826595 missense possibly damaging 0.75
IGL02148:Esco2 APN 14 65826595 missense probably benign 0.00
IGL03039:Esco2 APN 14 65831418 missense probably damaging 0.97
PIT4508001:Esco2 UTSW 14 65831465 missense probably damaging 0.99
R0400:Esco2 UTSW 14 65831706 missense possibly damaging 0.73
R0894:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1778:Esco2 UTSW 14 65831262 missense possibly damaging 0.47
R1795:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1962:Esco2 UTSW 14 65831533 missense probably damaging 1.00
R2325:Esco2 UTSW 14 65826578 splice site probably null
R2357:Esco2 UTSW 14 65826551 missense probably benign 0.32
R2369:Esco2 UTSW 14 65821740 missense probably damaging 1.00
R4659:Esco2 UTSW 14 65826586 missense possibly damaging 0.92
R5648:Esco2 UTSW 14 65831192 missense probably damaging 1.00
R6782:Esco2 UTSW 14 65820016 missense probably benign 0.00
R6877:Esco2 UTSW 14 65831045 missense probably benign 0.01
R7116:Esco2 UTSW 14 65826557 missense probably damaging 1.00
R7572:Esco2 UTSW 14 65831192 missense probably damaging 0.97
R7645:Esco2 UTSW 14 65827181 missense probably benign 0.08
R8055:Esco2 UTSW 14 65831719 missense probably benign 0.20
R8072:Esco2 UTSW 14 65832681 missense probably benign
R8483:Esco2 UTSW 14 65831669 missense probably benign 0.00
Z1177:Esco2 UTSW 14 65824936 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGATAGGGAAATGGCTACAC -3'
(R):5'- TGAGGATACACACGCATATTTAGC -3'

Sequencing Primer
(F):5'- TAGGGAAATGGCTACACAAAAAGAC -3'
(R):5'- TCCTGGAACTCACAGGCTGAC -3'
Posted On2017-02-10