Incidental Mutation 'R0556:Ppp1r12b'
ID45535
Institutional Source Beutler Lab
Gene Symbol Ppp1r12b
Ensembl Gene ENSMUSG00000073557
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12B
Synonyms9530009M10Rik, 1810037O03Rik
MMRRC Submission 038748-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R0556 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134754658-134955942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134777322 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 876 (Y876F)
Ref Sequence ENSEMBL: ENSMUSP00000047463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045665] [ENSMUST00000086444] [ENSMUST00000168381]
Predicted Effect probably damaging
Transcript: ENSMUST00000045665
AA Change: Y876F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557
AA Change: Y876F

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086444
AA Change: Y876F

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557
AA Change: Y876F

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156348
Predicted Effect possibly damaging
Transcript: ENSMUST00000168381
AA Change: Y876F

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557
AA Change: Y876F

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191540
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,943,951 Y113* probably null Het
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Bms1 A G 6: 118,413,179 Y227H probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Clec16a A G 16: 10,638,785 probably null Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Ddx54 T A 5: 120,619,654 probably benign Het
Dock7 A T 4: 98,945,189 L1925Q probably damaging Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in Ppp1r12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Ppp1r12b APN 1 134892159 missense probably damaging 1.00
IGL01788:Ppp1r12b APN 1 134893507 missense possibly damaging 0.66
IGL01880:Ppp1r12b APN 1 134886421 critical splice donor site probably null
IGL02109:Ppp1r12b APN 1 134872805 critical splice donor site probably null
IGL02247:Ppp1r12b APN 1 134835983 missense probably benign
IGL02336:Ppp1r12b APN 1 134886506 missense probably damaging 1.00
IGL02903:Ppp1r12b APN 1 134955649 missense probably benign
IGL02963:Ppp1r12b APN 1 134886548 missense probably damaging 1.00
IGL03074:Ppp1r12b APN 1 134836020 missense probably benign 0.01
IGL03302:Ppp1r12b APN 1 134838050 splice site probably benign
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0189:Ppp1r12b UTSW 1 134865776 critical splice donor site probably null
R0594:Ppp1r12b UTSW 1 134776479 missense probably damaging 1.00
R0690:Ppp1r12b UTSW 1 134876082 missense probably damaging 1.00
R1354:Ppp1r12b UTSW 1 134835983 missense probably benign 0.42
R1676:Ppp1r12b UTSW 1 134777452 missense probably damaging 1.00
R1775:Ppp1r12b UTSW 1 134893348 critical splice donor site probably null
R1839:Ppp1r12b UTSW 1 134837981 missense probably benign 0.32
R1946:Ppp1r12b UTSW 1 134892270 missense probably damaging 1.00
R1971:Ppp1r12b UTSW 1 134865913 missense probably benign 0.00
R1997:Ppp1r12b UTSW 1 134846355 intron probably benign
R3110:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3112:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3908:Ppp1r12b UTSW 1 134842732 missense probably damaging 1.00
R3912:Ppp1r12b UTSW 1 134887318 missense probably damaging 1.00
R3977:Ppp1r12b UTSW 1 134765975 missense probably benign 0.00
R4243:Ppp1r12b UTSW 1 134782108 intron probably benign
R4835:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4836:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4843:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4854:Ppp1r12b UTSW 1 134873951 missense probably damaging 1.00
R4870:Ppp1r12b UTSW 1 134949033 missense probably benign 0.00
R4881:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5024:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5054:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5055:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5056:Ppp1r12b UTSW 1 134834392 intron probably benign
R5056:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5158:Ppp1r12b UTSW 1 134886428 missense probably damaging 1.00
R5599:Ppp1r12b UTSW 1 134865907 missense probably benign 0.08
R5771:Ppp1r12b UTSW 1 134773424 critical splice donor site probably null
R5775:Ppp1r12b UTSW 1 134876042 missense probably benign
R5872:Ppp1r12b UTSW 1 134776406 missense probably benign 0.03
R5896:Ppp1r12b UTSW 1 134765981 missense probably damaging 1.00
R6060:Ppp1r12b UTSW 1 134955524 missense possibly damaging 0.82
R6129:Ppp1r12b UTSW 1 134892252 nonsense probably null
R6369:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R6868:Ppp1r12b UTSW 1 134886438 missense probably benign 0.00
R7681:Ppp1r12b UTSW 1 134865935 missense probably benign 0.02
R7940:Ppp1r12b UTSW 1 134876055 missense probably benign 0.00
R8057:Ppp1r12b UTSW 1 134955616 missense probably damaging 1.00
R8070:Ppp1r12b UTSW 1 134876069 missense probably benign 0.06
R8134:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R8147:Ppp1r12b UTSW 1 134873942 missense possibly damaging 0.78
R8224:Ppp1r12b UTSW 1 134902462 missense probably benign 0.19
R8270:Ppp1r12b UTSW 1 134876148 missense probably benign 0.37
R8304:Ppp1r12b UTSW 1 134896363 missense possibly damaging 0.65
X0022:Ppp1r12b UTSW 1 134835873 missense probably benign 0.00
X0027:Ppp1r12b UTSW 1 134896354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCAAAGACCAGAGAGCAAGAGC -3'
(R):5'- TCAAGGAAGGCAAGTTTCTGACCAG -3'

Sequencing Primer
(F):5'- AACAATGTACACGTCGTCTTTCG -3'
(R):5'- ctctctctctctctctctctcc -3'
Posted On2013-06-11