Incidental Mutation 'R5874:Rbm44'
ID455356
Institutional Source Beutler Lab
Gene Symbol Rbm44
Ensembl Gene ENSMUSG00000070732
Gene NameRNA binding motif protein 44
SynonymsLOC329207
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5874 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91145089-91170795 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 91156840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094698] [ENSMUST00000188818]
Predicted Effect probably null
Transcript: ENSMUST00000094698
SMART Domains Protein: ENSMUSP00000092286
Gene: ENSMUSG00000070732

DomainStartEndE-ValueType
low complexity region 227 238 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
RRM 793 861 8.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188818
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Male mice homozygous or heterozygous for a knock-out allele exhibit enhanced fertility with increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Rbm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rbm44 APN 1 91157109 missense probably benign
IGL01089:Rbm44 APN 1 91168697 missense possibly damaging 0.61
IGL01339:Rbm44 APN 1 91168964 missense probably benign 0.45
IGL01410:Rbm44 APN 1 91168829 missense probably benign 0.01
IGL01624:Rbm44 APN 1 91156658 missense probably damaging 0.96
IGL01963:Rbm44 APN 1 91163108 missense probably benign 0.00
IGL02067:Rbm44 APN 1 91152845 missense probably damaging 0.98
IGL02513:Rbm44 APN 1 91155538 missense possibly damaging 0.63
IGL02804:Rbm44 APN 1 91150176 intron probably benign
IGL02806:Rbm44 APN 1 91153077 missense possibly damaging 0.79
IGL02887:Rbm44 APN 1 91153180 missense probably damaging 1.00
IGL03309:Rbm44 APN 1 91168840 critical splice donor site probably null
R0360:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0364:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0647:Rbm44 UTSW 1 91156928 missense probably benign 0.00
R1345:Rbm44 UTSW 1 91152759 missense probably damaging 0.99
R1352:Rbm44 UTSW 1 91153042 missense probably damaging 1.00
R1575:Rbm44 UTSW 1 91156843 splice site probably null
R1768:Rbm44 UTSW 1 91153957 splice site probably null
R4901:Rbm44 UTSW 1 91153328 missense probably benign 0.13
R4913:Rbm44 UTSW 1 91155494 missense probably damaging 1.00
R5023:Rbm44 UTSW 1 91169098 critical splice donor site probably null
R5569:Rbm44 UTSW 1 91168738 missense probably damaging 0.99
R5981:Rbm44 UTSW 1 91152689 missense possibly damaging 0.61
R6441:Rbm44 UTSW 1 91157077 missense probably damaging 0.98
R6515:Rbm44 UTSW 1 91165138 missense probably damaging 0.96
R7380:Rbm44 UTSW 1 91152216 missense possibly damaging 0.77
R7783:Rbm44 UTSW 1 91168829 missense probably benign 0.01
R8004:Rbm44 UTSW 1 91152158 splice site probably benign
Z1176:Rbm44 UTSW 1 91153400 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTAAGAAGGAGTTAGGCG -3'
(R):5'- CAGAATTTGCTCCTGAAAGGCTG -3'

Sequencing Primer
(F):5'- ATACCTCTGGAAGAGCTG -3'
(R):5'- GCTCCTGAAAGGCTGAATAAATAAAC -3'
Posted On2017-02-10