Incidental Mutation 'R0556:Colgalt2'
ID 45536
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
MMRRC Submission 038748-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0556 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 152275581-152386446 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 152347564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect probably benign
Transcript: ENSMUST00000044311
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127586
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 15,164,213 (GRCm39) Y113* probably null Het
4930402F06Rik T C 2: 35,280,482 (GRCm39) probably benign Het
Acad11 A G 9: 103,992,501 (GRCm39) E481G probably damaging Het
Aldh1a1 A T 19: 20,611,842 (GRCm39) N389Y probably damaging Het
Bmpr2 C T 1: 59,854,487 (GRCm39) T112M probably damaging Het
Bms1 A G 6: 118,390,140 (GRCm39) Y227H probably damaging Het
Cab39 A G 1: 85,763,212 (GRCm39) probably benign Het
Ccn3 A T 15: 54,612,563 (GRCm39) T191S probably damaging Het
Ccno T C 13: 113,124,820 (GRCm39) probably null Het
Cct6b A G 11: 82,610,270 (GRCm39) probably benign Het
Cd101 A C 3: 100,927,970 (GRCm39) I37S probably damaging Het
Ces1a T C 8: 93,771,740 (GRCm39) H19R probably benign Het
Clec16a A G 16: 10,456,649 (GRCm39) probably null Het
Cntnap1 T C 11: 101,074,822 (GRCm39) F831S probably benign Het
Col24a1 A G 3: 145,020,489 (GRCm39) T287A possibly damaging Het
Cpd A G 11: 76,693,171 (GRCm39) probably benign Het
Cyp3a16 C A 5: 145,392,790 (GRCm39) M145I probably benign Het
Ddx54 T A 5: 120,757,719 (GRCm39) probably benign Het
Dock7 A T 4: 98,833,426 (GRCm39) L1925Q probably damaging Het
Eif4g1 A T 16: 20,494,544 (GRCm39) Y127F probably damaging Het
Erap1 T A 13: 74,808,444 (GRCm39) V52E probably damaging Het
Fbxo6 G T 4: 148,230,632 (GRCm39) T210N probably damaging Het
Fcgbpl1 C T 7: 27,858,803 (GRCm39) H2308Y probably benign Het
Garre1 T C 7: 33,939,222 (GRCm39) T222A probably damaging Het
Gnat3 T G 5: 18,224,596 (GRCm39) V332G probably damaging Het
Ift22 T A 5: 136,940,145 (GRCm39) probably null Het
Igkv4-71 A G 6: 69,220,171 (GRCm39) C109R probably damaging Het
Igsf10 A G 3: 59,236,296 (GRCm39) L1295P probably benign Het
Itga4 T C 2: 79,155,983 (GRCm39) I983T probably benign Het
Lhcgr A T 17: 89,079,491 (GRCm39) V65D probably damaging Het
Mau2 G C 8: 70,495,082 (GRCm39) T85R probably damaging Het
Morc2a T C 11: 3,631,809 (GRCm39) probably null Het
Morc2b A T 17: 33,356,812 (GRCm39) M320K probably benign Het
Ms4a18 C A 19: 10,991,065 (GRCm39) V10F probably damaging Het
Mstn A T 1: 53,103,284 (GRCm39) I207F probably benign Het
Mtor A G 4: 148,553,837 (GRCm39) E812G possibly damaging Het
Myo1h A G 5: 114,457,852 (GRCm39) Y121C probably damaging Het
Or11g27 T C 14: 50,771,381 (GRCm39) S171P probably benign Het
Or4a66 A C 2: 88,531,115 (GRCm39) V186G possibly damaging Het
Or8b53 A T 9: 38,667,041 (GRCm39) D19V possibly damaging Het
Plcd3 G A 11: 102,968,632 (GRCm39) T353M probably damaging Het
Pnpla7 T A 2: 24,942,313 (GRCm39) probably null Het
Ppp1r12b T A 1: 134,705,060 (GRCm39) Y876F probably damaging Het
Prelid2 T A 18: 42,084,245 (GRCm39) probably benign Het
Prickle1 A G 15: 93,398,662 (GRCm39) L722P probably benign Het
Prr12 A G 7: 44,680,093 (GRCm39) L1887P unknown Het
Ptk2b A G 14: 66,409,593 (GRCm39) L481P probably damaging Het
Rgl3 T A 9: 21,887,140 (GRCm39) K531* probably null Het
Sacs A G 14: 61,421,407 (GRCm39) I115V probably damaging Het
Septin3 G T 15: 82,167,966 (GRCm39) probably benign Het
Simc1 T C 13: 54,673,160 (GRCm39) S503P probably benign Het
Stard9 T C 2: 120,529,404 (GRCm39) V1887A probably benign Het
Synj2 T A 17: 6,088,230 (GRCm39) L1427* probably null Het
Taar2 A G 10: 23,816,793 (GRCm39) D111G probably damaging Het
Tlr5 A G 1: 182,801,716 (GRCm39) N340S probably damaging Het
Tmco2 A G 4: 120,966,314 (GRCm39) L14P probably damaging Het
Tnik A T 3: 28,679,367 (GRCm39) D746V possibly damaging Het
Trip11 C A 12: 101,850,777 (GRCm39) E811* probably null Het
Ttll9 T C 2: 152,815,526 (GRCm39) probably null Het
Uchl1 A G 5: 66,839,824 (GRCm39) E122G probably benign Het
Vwa3b C A 1: 37,203,566 (GRCm39) probably benign Het
Zan T C 5: 137,452,482 (GRCm39) N1533S unknown Het
Zfp687 G T 3: 94,917,719 (GRCm39) D684E probably damaging Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152,382,629 (GRCm39) missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152,384,481 (GRCm39) missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152,348,859 (GRCm39) missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152,360,622 (GRCm39) missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0605:Colgalt2 UTSW 1 152,371,543 (GRCm39) splice site probably benign
R0628:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152,347,495 (GRCm39) missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152,378,768 (GRCm39) missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152,348,912 (GRCm39) missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152,379,904 (GRCm39) missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152,360,655 (GRCm39) missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152,360,703 (GRCm39) missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152,276,114 (GRCm39) missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152,344,301 (GRCm39) missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152,347,495 (GRCm39) missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152,384,362 (GRCm39) nonsense probably null
R3917:Colgalt2 UTSW 1 152,384,362 (GRCm39) nonsense probably null
R4250:Colgalt2 UTSW 1 152,365,638 (GRCm39) missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152,344,282 (GRCm39) missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152,360,763 (GRCm39) missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152,382,627 (GRCm39) missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152,276,094 (GRCm39) missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152,365,627 (GRCm39) missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152,360,749 (GRCm39) missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152,375,710 (GRCm39) missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152,360,620 (GRCm39) missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152,276,054 (GRCm39) missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152,379,873 (GRCm39) missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152,348,912 (GRCm39) missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152,347,549 (GRCm39) missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152,382,579 (GRCm39) missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152,379,895 (GRCm39) missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152,378,823 (GRCm39) missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152,360,662 (GRCm39) missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152,360,662 (GRCm39) missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152,378,906 (GRCm39) intron probably benign
R9186:Colgalt2 UTSW 1 152,384,403 (GRCm39) missense probably damaging 0.98
R9393:Colgalt2 UTSW 1 152,360,598 (GRCm39) nonsense probably null
R9611:Colgalt2 UTSW 1 152,360,745 (GRCm39) missense probably damaging 1.00
X0028:Colgalt2 UTSW 1 152,347,471 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCATGCAGACACTCAGTGGC -3'
(R):5'- ACAAACAGGCGATTCCATTTCCCAG -3'

Sequencing Primer
(F):5'- CAGACACTCAGTGGCTGTAAATTC -3'
(R):5'- TCACTGCAAAGGCATCTGAG -3'
Posted On 2013-06-11