Incidental Mutation 'R5874:Frem2'
ID455367
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5874 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 53537489 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 2407 (G2407A)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably benign
Transcript: ENSMUST00000091137
AA Change: G2407A

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: G2407A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197519
Meta Mutation Damage Score 0.1315 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7922:Frem2 UTSW 3 53653304 missense probably damaging 0.98
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
R8176:Frem2 UTSW 3 53655340 missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53656507 nonsense probably null
R8397:Frem2 UTSW 3 53653141 missense probably benign 0.00
R8410:Frem2 UTSW 3 53539177 missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53525828 missense not run
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCATTGGTGTTCACTGCTCG -3'
(R):5'- CAGAGAAACTATCACAGCTGGG -3'

Sequencing Primer
(F):5'- ACATTGGACCCGGGAGC -3'
(R):5'- TCACAGCTGGGAATAAAAATTCAG -3'
Posted On2017-02-10