Incidental Mutation 'R5874:Tbc1d1'
ID455373
Institutional Source Beutler Lab
Gene Symbol Tbc1d1
Ensembl Gene ENSMUSG00000029174
Gene NameTBC1 domain family, member 1
SynonymsNob1, Nobq1, 1110062G02Rik
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5874 (G1)
Quality Score213
Status Validated
Chromosome5
Chromosomal Location64156305-64351486 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 64349930 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 1163 (*1163W)
Ref Sequence ENSEMBL: ENSMUSP00000112493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043893] [ENSMUST00000101195] [ENSMUST00000119756] [ENSMUST00000121370]
Predicted Effect probably null
Transcript: ENSMUST00000043893
AA Change: *1256W
SMART Domains Protein: ENSMUSP00000044577
Gene: ENSMUSG00000029174
AA Change: *1256W

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 2e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 2.5e-25 PFAM
TBC 884 1104 3.84e-89 SMART
Blast:TBC 1129 1186 5e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000101195
AA Change: *1163W
SMART Domains Protein: ENSMUSP00000098756
Gene: ENSMUSG00000029174
AA Change: *1163W

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000119756
AA Change: *1034W
SMART Domains Protein: ENSMUSP00000113643
Gene: ENSMUSG00000029174
AA Change: *1034W

DomainStartEndE-ValueType
PTB 39 249 5.93e-34 SMART
low complexity region 390 411 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
Pfam:DUF3350 555 610 2.9e-29 PFAM
TBC 662 882 3.84e-89 SMART
Blast:TBC 907 964 4e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000121370
AA Change: *1163W
SMART Domains Protein: ENSMUSP00000112493
Gene: ENSMUSG00000029174
AA Change: *1163W

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140960
Meta Mutation Damage Score 0.8635 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozgyous for a targeted mutation that removes exon 4 exhibit no adverse phenotype. Mice homozygous for a gene trap allele exhibit decreased body weight, resistance to diet-induced obesity, increased fat oxidization and decreased glucose uptake in the muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Tbc1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Tbc1d1 APN 5 64256992 missense probably damaging 1.00
IGL02341:Tbc1d1 APN 5 64275407 missense probably damaging 1.00
IGL02353:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02360:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02963:Tbc1d1 APN 5 64264366 missense probably damaging 1.00
IGL03003:Tbc1d1 APN 5 64316438 missense probably damaging 1.00
R0035:Tbc1d1 UTSW 5 64256737 missense probably damaging 1.00
R0084:Tbc1d1 UTSW 5 64324454 missense probably damaging 0.96
R0321:Tbc1d1 UTSW 5 64339594 missense probably damaging 1.00
R0559:Tbc1d1 UTSW 5 64173793 missense probably damaging 1.00
R1296:Tbc1d1 UTSW 5 64264432 missense probably damaging 1.00
R1922:Tbc1d1 UTSW 5 64311221 missense probably damaging 1.00
R1928:Tbc1d1 UTSW 5 64345300 missense probably damaging 1.00
R2095:Tbc1d1 UTSW 5 64316501 missense probably benign 0.01
R2107:Tbc1d1 UTSW 5 64284705 missense probably benign 0.19
R2253:Tbc1d1 UTSW 5 64284800 missense probably benign 0.00
R3545:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3546:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3547:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R4039:Tbc1d1 UTSW 5 64316428 missense probably damaging 0.99
R4289:Tbc1d1 UTSW 5 64260428 missense probably damaging 1.00
R4380:Tbc1d1 UTSW 5 64333548 missense probably benign 0.29
R4405:Tbc1d1 UTSW 5 64173670 missense possibly damaging 0.93
R4564:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R4722:Tbc1d1 UTSW 5 64263557 missense probably damaging 1.00
R4779:Tbc1d1 UTSW 5 64278046 critical splice donor site probably null
R5256:Tbc1d1 UTSW 5 64282009 missense probably damaging 1.00
R5268:Tbc1d1 UTSW 5 64324567 missense probably damaging 0.99
R5510:Tbc1d1 UTSW 5 64333395 missense probably damaging 1.00
R5547:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5620:Tbc1d1 UTSW 5 64173712 missense probably benign 0.44
R5680:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R6002:Tbc1d1 UTSW 5 64333433 missense probably damaging 1.00
R6058:Tbc1d1 UTSW 5 64278009 missense probably damaging 1.00
R6092:Tbc1d1 UTSW 5 64349899 missense probably benign 0.00
R6118:Tbc1d1 UTSW 5 64284037 missense probably damaging 0.98
R6183:Tbc1d1 UTSW 5 64275425 missense probably damaging 1.00
R6447:Tbc1d1 UTSW 5 64333493 missense probably damaging 1.00
R6824:Tbc1d1 UTSW 5 64256902 missense probably benign 0.02
R6913:Tbc1d1 UTSW 5 64311109 missense probably benign 0.26
R7039:Tbc1d1 UTSW 5 64284757 missense probably benign 0.08
R7150:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R7154:Tbc1d1 UTSW 5 64173813 missense possibly damaging 0.56
R7316:Tbc1d1 UTSW 5 64335277 critical splice acceptor site probably null
R7621:Tbc1d1 UTSW 5 64264330 missense probably damaging 1.00
R7653:Tbc1d1 UTSW 5 64256790 missense probably benign 0.21
R7684:Tbc1d1 UTSW 5 64316486 missense probably benign 0.13
R7816:Tbc1d1 UTSW 5 64349752 missense probably damaging 0.98
X0064:Tbc1d1 UTSW 5 64275452 missense probably benign 0.04
Z1088:Tbc1d1 UTSW 5 64275393 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTTGAAGCCACGGTAG -3'
(R):5'- CATGTCCATGCCATCTAAAGC -3'

Sequencing Primer
(F):5'- CGGTAGAGAAACTTCTTACCAGCG -3'
(R):5'- TGTCCATGCCATCTAAAGCTACAAC -3'
Posted On2017-02-10