Incidental Mutation 'R5874:Ankrd17'
ID455374
Institutional Source Beutler Lab
Gene Symbol Ankrd17
Ensembl Gene ENSMUSG00000055204
Gene Nameankyrin repeat domain 17
SynonymsA130069E23Rik, 4933425K22Rik, Gtar
MMRRC Submission 044081-MU
Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5874 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90227166-90366577 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 90268797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021] [ENSMUST00000218526]
Predicted Effect probably benign
Transcript: ENSMUST00000014421
SMART Domains Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
low complexity region 1597 1611 N/A INTRINSIC
low complexity region 1616 1636 N/A INTRINSIC
KH 1720 1790 8.31e-14 SMART
low complexity region 1816 1827 N/A INTRINSIC
low complexity region 1834 1850 N/A INTRINSIC
low complexity region 1946 1989 N/A INTRINSIC
low complexity region 1996 2024 N/A INTRINSIC
low complexity region 2035 2052 N/A INTRINSIC
low complexity region 2068 2077 N/A INTRINSIC
low complexity region 2086 2110 N/A INTRINSIC
low complexity region 2175 2189 N/A INTRINSIC
low complexity region 2348 2365 N/A INTRINSIC
low complexity region 2392 2411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081914
SMART Domains Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
low complexity region 795 809 N/A INTRINSIC
ANK 827 856 2.13e-4 SMART
ANK 860 889 8.19e-6 SMART
ANK 894 923 1.68e-2 SMART
ANK 927 956 1.61e-4 SMART
ANK 962 991 1.43e-5 SMART
ANK 996 1025 1.83e-3 SMART
ANK 1029 1058 3.91e-3 SMART
ANK 1064 1093 1.93e-2 SMART
ANK 1097 1126 8.78e-6 SMART
ANK 1130 1159 7.59e-1 SMART
coiled coil region 1203 1271 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1365 1385 N/A INTRINSIC
KH 1469 1539 8.31e-14 SMART
low complexity region 1565 1576 N/A INTRINSIC
low complexity region 1583 1599 N/A INTRINSIC
low complexity region 1695 1738 N/A INTRINSIC
low complexity region 1745 1773 N/A INTRINSIC
low complexity region 1784 1801 N/A INTRINSIC
low complexity region 1817 1826 N/A INTRINSIC
low complexity region 1835 1859 N/A INTRINSIC
low complexity region 1924 1938 N/A INTRINSIC
low complexity region 2097 2114 N/A INTRINSIC
low complexity region 2141 2160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168058
SMART Domains Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197021
SMART Domains Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204

DomainStartEndE-ValueType
ANK 120 149 5.4e-1 SMART
ANK 153 182 2e-3 SMART
ANK 187 216 2.2e-7 SMART
ANK 220 249 8.2e-8 SMART
ANK 253 282 2.2e-6 SMART
ANK 287 316 2.1e-6 SMART
ANK 320 349 9.9e-7 SMART
ANK 353 382 9.5e-5 SMART
ANK 386 415 2.4e-9 SMART
ANK 420 449 2.6e-5 SMART
ANK 450 479 1.1e-7 SMART
ANK 483 512 2.2e-7 SMART
ANK 516 545 3.5e-6 SMART
ANK 550 579 7.9e-6 SMART
ANK 583 612 8.9e-4 SMART
coiled coil region 691 774 N/A INTRINSIC
low complexity region 781 794 N/A INTRINSIC
low complexity region 846 859 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 937 951 N/A INTRINSIC
ANK 969 998 1.4e-6 SMART
ANK 1002 1031 5.3e-8 SMART
ANK 1036 1065 1e-4 SMART
ANK 1069 1098 1e-6 SMART
ANK 1104 1133 9.1e-8 SMART
ANK 1138 1167 1.2e-5 SMART
ANK 1171 1200 2.5e-5 SMART
ANK 1206 1235 1.2e-4 SMART
ANK 1239 1268 5.5e-8 SMART
ANK 1272 1301 4.7e-3 SMART
coiled coil region 1345 1413 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
KH 1611 1681 5.1e-16 SMART
low complexity region 1707 1718 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1837 1880 N/A INTRINSIC
low complexity region 1887 1915 N/A INTRINSIC
low complexity region 1926 1943 N/A INTRINSIC
low complexity region 1959 1968 N/A INTRINSIC
low complexity region 1977 2001 N/A INTRINSIC
low complexity region 2066 2080 N/A INTRINSIC
low complexity region 2239 2256 N/A INTRINSIC
low complexity region 2283 2302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200012
Predicted Effect probably benign
Transcript: ENSMUST00000218526
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
MGI Phenotype Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]
Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Ankrd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ankrd17 APN 5 90233928 missense probably damaging 0.98
IGL00484:Ankrd17 APN 5 90268361 missense probably damaging 0.99
IGL01320:Ankrd17 APN 5 90260129 missense probably damaging 0.99
IGL01776:Ankrd17 APN 5 90283364 nonsense probably null
IGL02093:Ankrd17 APN 5 90242963 missense possibly damaging 0.93
IGL02292:Ankrd17 APN 5 90252859 unclassified probably benign
IGL02302:Ankrd17 APN 5 90283198 missense probably benign 0.23
IGL02472:Ankrd17 APN 5 90264151 missense probably damaging 1.00
IGL02705:Ankrd17 APN 5 90283115 missense probably benign 0.15
IGL02727:Ankrd17 APN 5 90244292 missense possibly damaging 0.93
IGL02884:Ankrd17 APN 5 90264757 missense probably damaging 1.00
3-1:Ankrd17 UTSW 5 90243154 missense probably damaging 0.99
PIT1430001:Ankrd17 UTSW 5 90252973 missense possibly damaging 0.91
R0025:Ankrd17 UTSW 5 90250405 missense probably damaging 0.99
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0271:Ankrd17 UTSW 5 90254799 missense possibly damaging 0.90
R0684:Ankrd17 UTSW 5 90263998 missense probably damaging 0.99
R1239:Ankrd17 UTSW 5 90288676 missense probably damaging 0.99
R1457:Ankrd17 UTSW 5 90285846 missense possibly damaging 0.92
R1505:Ankrd17 UTSW 5 90300026 missense possibly damaging 0.53
R1766:Ankrd17 UTSW 5 90264797 missense possibly damaging 0.95
R1770:Ankrd17 UTSW 5 90243376 missense possibly damaging 0.84
R1780:Ankrd17 UTSW 5 90232415 missense probably damaging 0.96
R1916:Ankrd17 UTSW 5 90260141 missense probably damaging 1.00
R1926:Ankrd17 UTSW 5 90244169 missense probably damaging 1.00
R2090:Ankrd17 UTSW 5 90298046 missense possibly damaging 0.92
R2153:Ankrd17 UTSW 5 90234059 missense probably damaging 0.98
R2279:Ankrd17 UTSW 5 90264717 missense probably damaging 1.00
R2420:Ankrd17 UTSW 5 90289320 missense possibly damaging 0.94
R3012:Ankrd17 UTSW 5 90230868 missense probably damaging 1.00
R3417:Ankrd17 UTSW 5 90243913 missense possibly damaging 0.86
R3704:Ankrd17 UTSW 5 90243969 missense possibly damaging 0.72
R4581:Ankrd17 UTSW 5 90283120 missense possibly damaging 0.67
R4850:Ankrd17 UTSW 5 90264786 missense probably damaging 1.00
R4926:Ankrd17 UTSW 5 90300032 missense probably damaging 1.00
R5023:Ankrd17 UTSW 5 90282868 missense probably damaging 1.00
R5068:Ankrd17 UTSW 5 90254808 missense probably damaging 0.96
R5109:Ankrd17 UTSW 5 90243536 missense possibly damaging 0.83
R5111:Ankrd17 UTSW 5 90242999 missense possibly damaging 0.85
R5214:Ankrd17 UTSW 5 90283460 missense possibly damaging 0.48
R5362:Ankrd17 UTSW 5 90265545 missense probably damaging 1.00
R5576:Ankrd17 UTSW 5 90243224 missense probably benign 0.00
R5615:Ankrd17 UTSW 5 90283436 missense possibly damaging 0.88
R5932:Ankrd17 UTSW 5 90265436 missense probably damaging 1.00
R5944:Ankrd17 UTSW 5 90285843 missense probably damaging 1.00
R5993:Ankrd17 UTSW 5 90339672 intron probably benign
R6052:Ankrd17 UTSW 5 90253832 missense probably benign 0.03
R6088:Ankrd17 UTSW 5 90253688 missense possibly damaging 0.95
R6306:Ankrd17 UTSW 5 90244154 missense probably benign 0.03
R6418:Ankrd17 UTSW 5 90278345 missense possibly damaging 0.89
R6663:Ankrd17 UTSW 5 90264064 missense probably damaging 1.00
R6758:Ankrd17 UTSW 5 90263313 missense probably damaging 1.00
R6782:Ankrd17 UTSW 5 90254738 missense possibly damaging 0.91
R6793:Ankrd17 UTSW 5 90265512 missense probably damaging 1.00
R6929:Ankrd17 UTSW 5 90285525 missense possibly damaging 0.86
R7008:Ankrd17 UTSW 5 90260096 missense possibly damaging 0.93
R7051:Ankrd17 UTSW 5 90366451 unclassified probably benign
R7077:Ankrd17 UTSW 5 90285864 missense possibly damaging 0.92
R7134:Ankrd17 UTSW 5 90232314 missense probably damaging 0.99
R7134:Ankrd17 UTSW 5 90285523 missense probably benign 0.03
R7138:Ankrd17 UTSW 5 90242977 missense probably benign 0.38
R7143:Ankrd17 UTSW 5 90285961 missense possibly damaging 0.85
R7173:Ankrd17 UTSW 5 90260117 missense possibly damaging 0.95
R7176:Ankrd17 UTSW 5 90268735 missense probably damaging 0.99
R7365:Ankrd17 UTSW 5 90291151 missense possibly damaging 0.45
R7390:Ankrd17 UTSW 5 90282920 missense probably benign 0.13
R7430:Ankrd17 UTSW 5 90295657 missense possibly damaging 0.80
R7468:Ankrd17 UTSW 5 90243043 missense probably benign
R7483:Ankrd17 UTSW 5 90299996 missense probably benign 0.00
R7492:Ankrd17 UTSW 5 90233948 missense possibly damaging 0.85
R7610:Ankrd17 UTSW 5 90232363 missense possibly damaging 0.93
R7636:Ankrd17 UTSW 5 90232380 missense possibly damaging 0.53
R7790:Ankrd17 UTSW 5 90260152 missense possibly damaging 0.61
X0019:Ankrd17 UTSW 5 90298654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATACTTGGCTATAAGCTGTTG -3'
(R):5'- GTTTGGCTAGTCATTGATAGAAGAG -3'

Sequencing Primer
(F):5'- AACTGACAAAAATAAGGGCTACC -3'
(R):5'- GTTGTTAGTAAACCACATAGCATCC -3'
Posted On2017-02-10