Incidental Mutation 'R5874:Olfr470'
ID455390
Institutional Source Beutler Lab
Gene Symbol Olfr470
Ensembl Gene ENSMUSG00000109542
Gene Nameolfactory receptor 470
SynonymsMOR204-22, GA_x6K02T2PBJ9-10175273-10174329
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R5874 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107842905-107847490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107845170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 188 (I188L)
Ref Sequence ENSEMBL: ENSMUSP00000151543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000220193]
Predicted Effect probably benign
Transcript: ENSMUST00000073059
AA Change: I188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: I188L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084757
AA Change: I188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081812
Gene: ENSMUSG00000094289
AA Change: I188L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-51 PFAM
Pfam:7tm_1 44 293 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219309
Predicted Effect probably benign
Transcript: ENSMUST00000220193
AA Change: I188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Olfr470
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr470 APN 7 107845178 missense probably benign 0.00
IGL02349:Olfr470 APN 7 107845605 missense probably benign 0.03
IGL02365:Olfr470 APN 7 107844912 missense probably damaging 1.00
R0070:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R0540:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0607:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0624:Olfr470 UTSW 7 107845116 missense possibly damaging 0.87
R1983:Olfr470 UTSW 7 107845412 missense probably benign 0.36
R2420:Olfr470 UTSW 7 107844818 missense probably benign 0.03
R2441:Olfr470 UTSW 7 107844978 missense probably benign 0.10
R4395:Olfr470 UTSW 7 107845262 missense probably damaging 1.00
R4734:Olfr470 UTSW 7 107845428 missense probably benign 0.00
R4779:Olfr470 UTSW 7 107845548 missense possibly damaging 0.96
R6598:Olfr470 UTSW 7 107845263 missense probably benign 0.06
R6807:Olfr470 UTSW 7 107845590 missense possibly damaging 0.67
R6820:Olfr470 UTSW 7 107845091 missense probably benign 0.01
R7305:Olfr470 UTSW 7 107845365 missense probably damaging 1.00
R7413:Olfr470 UTSW 7 107845514 missense probably damaging 1.00
R7954:Olfr470 UTSW 7 107844912 missense probably benign 0.01
R8215:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R8255:Olfr470 UTSW 7 107845161 missense probably damaging 1.00
R8384:Olfr470 UTSW 7 107845258 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTAGCTGGATTTGGGCATC -3'
(R):5'- ACTTGAGTGCTTCCTTCTGG -3'

Sequencing Primer
(F):5'- TCCATAATAGAGAGTCACTGCAGTG -3'
(R):5'- CCATGGCTTATGATCGTTTTATAGC -3'
Posted On2017-02-10