Mutagenetix > Incidental Mutation

Incidental Mutation 'R5874:Pkd1l1'

455398

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

044081-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8908688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 615 (L615P)

Ref Sequence

ENSEMBL: ENSMUSP00000136518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000154153
AA Change: L1065P

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: L1065P

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000178195
AA Change: L615P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: L615P

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Meta Mutation Damage Score

0.6387

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.6%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	A	T	9: 51,290,372	L128*	probably null	Het
2410131K14Rik	T	C	5: 118,259,439	V162A	probably damaging	Het
4930432E11Rik	G	A	7: 29,581,185		noncoding transcript	Het
Adam17	T	C	12: 21,329,086	D654G	possibly damaging	Het
Ankhd1	A	T	18: 36,640,269	H1373L	possibly damaging	Het
Ankrd17	T	C	5: 90,268,797		probably benign	Het
Calu	A	G	6: 29,372,618	D112G	probably damaging	Het
Camk2a	G	C	18: 60,943,200		probably benign	Het
Ccdc130	T	A	8: 84,258,548	D364V	possibly damaging	Het
Cpn1	C	A	19: 43,956,512	R452L	probably benign	Het
Csmd3	T	A	15: 47,644,270	E2780V	probably damaging	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cuedc2	C	T	19: 46,331,385	V164M	possibly damaging	Het
Cyp2d34	T	A	15: 82,619,042	D74V	probably benign	Het
Ddi2	A	G	4: 141,695,469	S311P	probably damaging	Het
Ddx10	A	C	9: 53,229,198	I301R	possibly damaging	Het
Dmpk	T	C	7: 19,092,082		probably benign	Het
Dnah7b	C	T	1: 46,191,725	T1381I	probably damaging	Het
Dst	T	A	1: 34,179,589	N1703K	probably damaging	Het
Dtwd1	T	A	2: 126,158,439	H98Q	probably damaging	Het
Ecel1	A	C	1: 87,148,009	V769G	probably benign	Het
Eno4	T	C	19: 58,946,806	V150A	probably benign	Het
Evc2	C	T	5: 37,417,539		probably benign	Het
Ext1	T	A	15: 53,101,752	Q406L	possibly damaging	Het
Fam104a	T	A	11: 113,677,394	R78S	probably damaging	Het
Fam35a	T	C	14: 34,245,258	T114A	probably benign	Het
Foxf2	A	G	13: 31,626,792	H238R	probably benign	Het
Frem2	C	G	3: 53,537,489	G2407A	probably benign	Het
Fzd10	A	G	5: 128,601,300	E28G	probably benign	Het
Galnt15	T	C	14: 32,052,367	F363L	probably damaging	Het
Gm1758	C	T	16: 14,507,173		noncoding transcript	Het
Gm5866	C	T	5: 52,582,614		noncoding transcript	Het
Gm6614	A	T	6: 141,972,235	H638Q	probably benign	Het
Heatr9	T	A	11: 83,514,600	M345L	probably benign	Het
Il23r	A	T	6: 67,431,645	F404Y	possibly damaging	Het
Lrrc8a	T	C	2: 30,257,136	I654T	probably damaging	Het
Napg	A	T	18: 62,978,020	K18*	probably null	Het
Ndst3	A	T	3: 123,561,907	W573R	probably damaging	Het
Nin	T	C	12: 70,030,918	S1038G	possibly damaging	Het
Nudt12	T	A	17: 59,010,284	R123*	probably null	Het
Oas1g	T	A	5: 120,877,018	N361Y	probably benign	Het
Olfr1100	A	T	2: 86,978,442	M118K	probably damaging	Het
Olfr1351	T	A	10: 79,017,357	F12I	possibly damaging	Het
Olfr470	T	A	7: 107,845,170	I188L	probably benign	Het
Osbpl10	T	C	9: 115,226,760	F667L	probably damaging	Het
Phldb2	T	C	16: 45,801,625	D664G	probably damaging	Het
Piezo2	C	T	18: 63,027,901	V2263M	probably damaging	Het
Pnpla7	G	A	2: 25,011,649	M562I	probably benign	Het
Ppp1r13b	C	A	12: 111,844,989	R155L	probably damaging	Het
Pygb	C	T	2: 150,786,878	P4L	probably benign	Het
Rbm44	T	C	1: 91,156,840		probably null	Het
Rilpl2	T	C	5: 124,469,813	T115A	probably benign	Het
Rin3	A	G	12: 102,389,843	Y801C	probably damaging	Het
Rnf112	A	G	11: 61,449,447	V619A	probably damaging	Het
Rnf182	A	G	13: 43,668,087	E38G	probably benign	Het
Scgb2b24	T	A	7: 33,737,405	Y94F	probably damaging	Het
Serac1	C	A	17: 6,043,913		probably benign	Het
Slc6a19	A	T	13: 73,684,368	V402D	probably damaging	Het
Slco2b1	T	A	7: 99,667,094	M410L	probably benign	Het
Smarca2	T	C	19: 26,776,069		probably benign	Het
Sned1	A	G	1: 93,265,345	Y409C	probably damaging	Het
Sorcs2	A	G	5: 36,229,211	V161A	probably damaging	Het
Sptb	T	C	12: 76,598,727	E2029G	possibly damaging	Het
Stx7	T	A	10: 24,182,761		probably null	Het
Taf4b	T	C	18: 14,804,554	V228A	probably benign	Het
Tbc1d1	A	G	5: 64,349,930	*1163W	probably null	Het
Tor4a	G	A	2: 25,194,835	A352V	probably damaging	Het
Trpm4	A	G	7: 45,327,749	F81S	probably damaging	Het
Ttn	T	A	2: 76,950,092	D1105V	probably damaging	Het
Zfp551	A	G	7: 12,416,174	L436P	probably damaging	Het
Zfp975	G	T	7: 42,662,888	D100E	probably benign	Het
Zswim3	A	G	2: 164,820,112	I171V	probably benign	Het
Zwint	C	T	10: 72,656,462		probably benign	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
R9009:Pkd1l1	UTSW	11	8931552	missense
R9099:Pkd1l1	UTSW	11	8972986	missense
R9119:Pkd1l1	UTSW	11	8879107	missense
R9150:Pkd1l1	UTSW	11	8836256	missense
R9314:Pkd1l1	UTSW	11	8879153	missense
R9341:Pkd1l1	UTSW	11	8836399	missense
R9341:Pkd1l1	UTSW	11	8961305	missense
R9343:Pkd1l1	UTSW	11	8836399	missense
R9343:Pkd1l1	UTSW	11	8961305	missense
R9392:Pkd1l1	UTSW	11	8844567	missense
R9424:Pkd1l1	UTSW	11	8870091	missense
R9496:Pkd1l1	UTSW	11	8833773	critical splice donor site	probably null
R9504:Pkd1l1	UTSW	11	8865631	missense
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- TGGAAATTTGCAGCACTTGAG -3'
(R):5'- TGGTCTTGGTCCAAAAGGGC -3'

Sequencing Primer
(F):5'- TTTGCAGCACTTGAGAGAGAACTG -3'
(R):5'- TCTTGGTCCAAAAGGGCTAGACTC -3'

Posted On

2017-02-10