Incidental Mutation 'R5874:Cuedc2'
ID455428
Institutional Source Beutler Lab
Gene Symbol Cuedc2
Ensembl Gene ENSMUSG00000036748
Gene NameCUE domain containing 2
Synonyms3010002G01Rik
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5874 (G1)
Quality Score214
Status Validated
Chromosome19
Chromosomal Location46329812-46338660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46331385 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 164 (V164M)
Ref Sequence ENSEMBL: ENSMUSP00000129589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026256] [ENSMUST00000041391] [ENSMUST00000051234] [ENSMUST00000096029] [ENSMUST00000167861] [ENSMUST00000177667] [ENSMUST00000223903] [ENSMUST00000223917] [ENSMUST00000224447] [ENSMUST00000225781]
Predicted Effect probably benign
Transcript: ENSMUST00000026256
SMART Domains Protein: ENSMUSP00000026256
Gene: ENSMUSG00000025226

DomainStartEndE-ValueType
Pfam:F-box 18 63 1.9e-6 PFAM
low complexity region 76 84 N/A INTRINSIC
LRR 113 138 1.01e1 SMART
LRR 139 164 1.89e-1 SMART
LRR 165 190 2.27e-4 SMART
LRR 192 217 3.47e0 SMART
LRR 218 243 2.57e-3 SMART
LRR 244 269 2.05e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000051234
AA Change: V164M

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053469
Gene: ENSMUSG00000036748
AA Change: V164M

DomainStartEndE-ValueType
Pfam:CUE 144 183 4.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000167861
AA Change: V164M

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129589
Gene: ENSMUSG00000036748
AA Change: V164M

DomainStartEndE-ValueType
Pfam:CUE 144 183 5.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177667
SMART Domains Protein: ENSMUSP00000137489
Gene: ENSMUSG00000025226

DomainStartEndE-ValueType
Pfam:F-box 18 63 2.1e-6 PFAM
low complexity region 76 84 N/A INTRINSIC
LRR 113 138 1.01e1 SMART
LRR 139 164 1.89e-1 SMART
LRR 165 190 2.27e-4 SMART
LRR 192 217 3.47e0 SMART
LRR 218 243 2.57e-3 SMART
LRR 244 269 2.05e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180538
Predicted Effect probably benign
Transcript: ENSMUST00000223903
Predicted Effect probably benign
Transcript: ENSMUST00000223917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224444
Predicted Effect probably benign
Transcript: ENSMUST00000224447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225072
Predicted Effect probably benign
Transcript: ENSMUST00000225781
Meta Mutation Damage Score 0.1282 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Cuedc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Cuedc2 APN 19 46331920 missense probably damaging 1.00
IGL01155:Cuedc2 APN 19 46332649 missense probably damaging 1.00
IGL01733:Cuedc2 APN 19 46332673 missense probably damaging 1.00
R1656:Cuedc2 UTSW 19 46331988 missense probably damaging 0.99
R1778:Cuedc2 UTSW 19 46331640 missense probably benign 0.00
R2905:Cuedc2 UTSW 19 46332649 missense probably benign 0.16
R5801:Cuedc2 UTSW 19 46331357 missense probably damaging 0.99
R8511:Cuedc2 UTSW 19 46330919 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTAAGCCCAGTGGTAAC -3'
(R):5'- ACCCTAGATGAGGTACTGCGAG -3'

Sequencing Primer
(F):5'- CACTTAGCAAGAAGGGCAGC -3'
(R):5'- TACTGCGAGAGGACCCAC -3'
Posted On2017-02-10