Incidental Mutation 'R5875:Sec16a'
ID455432
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26433367 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1272 (Y1272H)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: Y1272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: Y1272H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114082
AA Change: Y1272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: Y1272H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156442
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26438748 missense
Z1177:Sec16a UTSW 2 26439321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCATTTCCAGATGTGCAGAATTC -3'
(R):5'- CCTGGTTAGAGTTTTCCATAGCC -3'

Sequencing Primer
(F):5'- GACACTGGATCTCATTACAGATGGC -3'
(R):5'- CCATAGCCGAGGTGTCTTCATG -3'
Posted On2017-02-10