Incidental Mutation 'R5875:Exosc9'
ID455442
Institutional Source Beutler Lab
Gene Symbol Exosc9
Ensembl Gene ENSMUSG00000027714
Gene Nameexosome component 9
SynonymsRRP45, PM/Scl-75, p6, p5, Pmscl1
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36552606-36565727 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 36561193 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029269] [ENSMUST00000029270] [ENSMUST00000136890] [ENSMUST00000147380] [ENSMUST00000155866] [ENSMUST00000196316]
Predicted Effect probably null
Transcript: ENSMUST00000029269
SMART Domains Protein: ENSMUSP00000029269
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 1.7e-25 PFAM
Pfam:RNase_PH_C 189 255 3.4e-14 PFAM
low complexity region 308 324 N/A INTRINSIC
low complexity region 348 366 N/A INTRINSIC
low complexity region 396 406 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029270
SMART Domains Protein: ENSMUSP00000029270
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
Pfam:Cyclin_N2 22 157 7.2e-50 PFAM
CYCLIN 206 290 1.07e-28 SMART
Cyclin_C 299 417 4.09e-31 SMART
CYCLIN 303 386 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131316
SMART Domains Protein: ENSMUSP00000117235
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133854
Predicted Effect probably benign
Transcript: ENSMUST00000136890
SMART Domains Protein: ENSMUSP00000121047
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 1 79 3e-16 PFAM
Pfam:RNase_PH_C 105 147 3.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138636
Predicted Effect probably benign
Transcript: ENSMUST00000147380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149041
Predicted Effect probably benign
Transcript: ENSMUST00000155866
SMART Domains Protein: ENSMUSP00000122189
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 2.6e-25 PFAM
Pfam:RNase_PH_C 189 241 1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156100
Predicted Effect probably null
Transcript: ENSMUST00000156100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156575
Predicted Effect probably benign
Transcript: ENSMUST00000196316
SMART Domains Protein: ENSMUSP00000142946
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
CYCLIN 69 153 6.6e-31 SMART
Cyclin_C 162 280 2e-35 SMART
CYCLIN 166 249 6.1e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the human exosome, a exoribonuclease complex which processes and degrades RNA in the nucleus and cytoplasm. This component may play a role in mRNA degradation and the polymyositis/scleroderma autoantigen complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Exosc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Exosc9 APN 3 36553139 unclassified probably benign
IGL00949:Exosc9 APN 3 36563266 unclassified probably benign
IGL01718:Exosc9 APN 3 36553929 unclassified probably benign
IGL02072:Exosc9 APN 3 36554672 missense probably damaging 1.00
IGL02217:Exosc9 APN 3 36552744 missense probably damaging 0.99
IGL02439:Exosc9 APN 3 36553031 unclassified probably benign
IGL02871:Exosc9 APN 3 36565281 missense probably benign 0.00
IGL02994:Exosc9 APN 3 36553138 unclassified probably benign
IGL03144:Exosc9 APN 3 36554135 missense probably damaging 1.00
R0909:Exosc9 UTSW 3 36554704 missense probably damaging 1.00
R1192:Exosc9 UTSW 3 36552755 unclassified probably benign
R2516:Exosc9 UTSW 3 36563162 missense probably benign
R4288:Exosc9 UTSW 3 36563216 missense probably benign
R4770:Exosc9 UTSW 3 36553835 missense probably damaging 0.98
R5928:Exosc9 UTSW 3 36555625 intron probably benign
R6120:Exosc9 UTSW 3 36554672 missense probably damaging 1.00
R7077:Exosc9 UTSW 3 36553056 missense probably damaging 1.00
R7340:Exosc9 UTSW 3 36561148 missense possibly damaging 0.86
R7443:Exosc9 UTSW 3 36553841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTATTCCTGAGCACAC -3'
(R):5'- CTCAAGTCAGCTGTAGGGGAAG -3'

Sequencing Primer
(F):5'- GAGCACACTTTATCTGTGATCTCTG -3'
(R):5'- TTGAGCGGCAAACCAGC -3'
Posted On2017-02-10