Incidental Mutation 'R5875:Mindy1'
ID455443
Institutional Source Beutler Lab
Gene Symbol Mindy1
Ensembl Gene ENSMUSG00000038712
Gene NameMINDY lysine 48 deubiquitinase 1
Synonyms4930504E06Rik, cI-40, NF-E2 inducible protein, 1810005H09Rik, Fam63a
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95281345-95296166 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95294814 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 334 (V334A)
Ref Sequence ENSEMBL: ENSMUSP00000127839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000039537] [ENSMUST00000107183] [ENSMUST00000107187] [ENSMUST00000164406] [ENSMUST00000168223]
Predicted Effect probably benign
Transcript: ENSMUST00000015846
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039537
AA Change: V334A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043910
Gene: ENSMUSG00000038712
AA Change: V334A

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107183
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107187
AA Change: V334A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102805
Gene: ENSMUSG00000038712
AA Change: V334A

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 266 7e-42 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 400 406 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135264
Predicted Effect probably benign
Transcript: ENSMUST00000164406
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168223
AA Change: V334A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127839
Gene: ENSMUSG00000038712
AA Change: V334A

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Mindy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Mindy1 APN 3 95288390 missense probably damaging 1.00
IGL03380:Mindy1 APN 3 95291018 splice site probably benign
ANU18:Mindy1 UTSW 3 95288390 missense probably damaging 1.00
PIT4576001:Mindy1 UTSW 3 95288069 missense probably benign 0.12
R4647:Mindy1 UTSW 3 95282743 unclassified probably benign
R5076:Mindy1 UTSW 3 95295399 missense probably benign 0.01
R5938:Mindy1 UTSW 3 95293756 missense probably benign 0.18
X0028:Mindy1 UTSW 3 95294895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGCTGCTTCTCTGACACC -3'
(R):5'- TTCTGTGCCATTCCAAGAGGC -3'

Sequencing Primer
(F):5'- GACACCTCTCCCACCATTTTG -3'
(R):5'- GAGGCCCCACACACCTG -3'
Posted On2017-02-10