Incidental Mutation 'R5875:Ptprb'
ID455482
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 116348166 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 1628 (W1628G)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: W1341G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: W1341G

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: W1628G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
R7833:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7834:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7846:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7901:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7912:Ptprb UTSW 10 116322487 missense probably damaging 1.00
R7916:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7917:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7929:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7979:Ptprb UTSW 10 116369457 splice site probably null
R7984:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7993:Ptprb UTSW 10 116322487 missense probably damaging 1.00
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Z1176:Ptprb UTSW 10 116302156 frame shift probably null
Z1177:Ptprb UTSW 10 116362642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTTGCAAACACCTCCTTGGC -3'
(R):5'- GCATTGCTGTTAGCTGAATGAATG -3'

Sequencing Primer
(F):5'- TCCTTGGCTATCACCTGGAAGG -3'
(R):5'- TGCTGTTAGCTGAATGAATGCAAAG -3'
Posted On2017-02-10