Incidental Mutation 'R5875:Dyrk2'
ID455483
Institutional Source Beutler Lab
Gene Symbol Dyrk2
Ensembl Gene ENSMUSG00000028630
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Synonyms1810038L18Rik
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location118855603-118870209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118860697 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 219 (R219W)
Ref Sequence ENSEMBL: ENSMUSP00000004281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004281]
Predicted Effect probably damaging
Transcript: ENSMUST00000004281
AA Change: R219W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: R219W

DomainStartEndE-ValueType
S_TKc 220 533 1.16e-92 SMART
low complexity region 560 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218692
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Dyrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dyrk2 APN 10 118859844 missense probably damaging 1.00
IGL00536:Dyrk2 APN 10 118860192 missense probably damaging 1.00
IGL01288:Dyrk2 APN 10 118860699 missense probably damaging 1.00
IGL01375:Dyrk2 APN 10 118860687 missense probably damaging 1.00
IGL01637:Dyrk2 APN 10 118860507 missense probably damaging 1.00
IGL02052:Dyrk2 APN 10 118860543 missense probably damaging 1.00
R0452:Dyrk2 UTSW 10 118868763 missense possibly damaging 0.91
R0833:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R0836:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R1346:Dyrk2 UTSW 10 118859719 missense possibly damaging 0.92
R1610:Dyrk2 UTSW 10 118859925 missense probably benign 0.02
R2397:Dyrk2 UTSW 10 118861368 intron probably benign
R2409:Dyrk2 UTSW 10 118860627 missense probably benign
R2965:Dyrk2 UTSW 10 118860337 nonsense probably null
R2966:Dyrk2 UTSW 10 118860337 nonsense probably null
R4700:Dyrk2 UTSW 10 118868286 missense probably benign
R4896:Dyrk2 UTSW 10 118868248 missense probably damaging 0.96
R4978:Dyrk2 UTSW 10 118860347 missense probably benign 0.00
R5393:Dyrk2 UTSW 10 118859848 missense probably damaging 0.98
R5442:Dyrk2 UTSW 10 118860738 missense possibly damaging 0.72
R5496:Dyrk2 UTSW 10 118860051 missense probably damaging 1.00
R5810:Dyrk2 UTSW 10 118860340 missense probably benign 0.16
R5930:Dyrk2 UTSW 10 118860268 missense probably damaging 1.00
R6877:Dyrk2 UTSW 10 118860423 missense probably damaging 1.00
R7234:Dyrk2 UTSW 10 118860231 missense possibly damaging 0.84
R7442:Dyrk2 UTSW 10 118859881 missense probably damaging 1.00
R7741:Dyrk2 UTSW 10 118859689 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGAAGTTCTCCAGCATGTG -3'
(R):5'- TGGGGAAGGTAAAAGCCTCC -3'

Sequencing Primer
(F):5'- CAGCATGTGGATGACGTTCATAG -3'
(R):5'- GGTAAAAGCCTCCCCCATG -3'
Posted On2017-02-10