Mutagenetix > Incidental Mutation

Incidental Mutation 'R5875:Ints2'

455486

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

044082-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5875 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86238312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 482 (S482G)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: S482G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: S482G

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: S482G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: S482G

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.4%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810024B03Rik	A	G	2: 127,186,817	V154A	possibly damaging	Het
2900055J20Rik	T	A	18: 40,257,394		probably benign	Het
4931417E11Rik	T	C	6: 73,469,045	I174V	possibly damaging	Het
4933417A18Rik	T	G	13: 34,932,446	C59W	probably damaging	Het
Abcc1	A	G	16: 14,467,037	E1250G	possibly damaging	Het
Ajap1	A	C	4: 153,432,341	I181R	probably damaging	Het
Akap9	A	G	5: 4,077,285	Y3711C	probably benign	Het
Arl1	T	C	10: 88,741,979	S137P	probably benign	Het
Atp6v0a2	G	A	5: 124,716,327	V583I	probably benign	Het
Cdca7	T	A	2: 72,483,557	M230K	probably benign	Het
Chd9	A	T	8: 91,051,836	D2841V	probably damaging	Het
Chp1	T	A	2: 119,571,815	F90Y	probably damaging	Het
Ckap5	A	G	2: 91,560,861	T345A	probably benign	Het
Clca4b	A	C	3: 144,922,889	S352R	probably benign	Het
Cmya5	A	G	13: 93,095,184	V1132A	probably benign	Het
Crb2	T	A	2: 37,787,254		probably null	Het
Crhbp	A	G	13: 95,443,796	F99L	probably benign	Het
Dnmt3l	A	T	10: 78,053,938	M210L	probably benign	Het
Dyrk2	T	A	10: 118,860,697	R219W	probably damaging	Het
Exosc1	A	G	19: 41,928,103	I78T	probably damaging	Het
Exosc9	T	C	3: 36,561,193		probably null	Het
Frmd5	A	G	2: 121,558,478		probably benign	Het
Gata2	T	C	6: 88,202,491	L315P	probably damaging	Het
Gm17067	G	A	7: 42,708,046	T344I	probably benign	Het
Gm4884	A	T	7: 41,042,936	T110S	possibly damaging	Het
Hapln3	T	C	7: 79,121,973	E56G	probably benign	Het
Helq	A	C	5: 100,796,470	I258S	probably damaging	Het
Hoxd10	T	C	2: 74,692,082	Y35H	possibly damaging	Het
Inpp5b	T	C	4: 124,780,406	V302A	possibly damaging	Het
Inpp5d	T	A	1: 87,717,974	I1027N	possibly damaging	Het
Itih1	C	T	14: 30,929,530	V902I	probably benign	Het
Kif27	T	C	13: 58,311,104	N971S	probably benign	Het
Klra17	T	C	6: 129,874,828	D27G	probably benign	Het
Leo1	G	C	9: 75,450,560	R412S	probably damaging	Het
Lonrf2	T	C	1: 38,807,047	N348S	probably benign	Het
Lpp	G	A	16: 24,608,309	G62E	probably benign	Het
Lyn	G	A	4: 3,745,631		probably null	Het
Macf1	T	A	4: 123,432,314	N5128I	possibly damaging	Het
Mapk7	T	A	11: 61,493,698	I61L	probably benign	Het
Mindy1	T	C	3: 95,294,814	V334A	probably damaging	Het
Muc20	G	A	16: 32,793,819	T396I	possibly damaging	Het
Myo5b	A	T	18: 74,707,902		probably null	Het
Noc4l	A	C	5: 110,651,310		probably null	Het
Oas1c	A	G	5: 120,805,562	Y171H	probably damaging	Het
Pclo	A	T	5: 14,680,600		probably benign	Het
Pmpcb	G	A	5: 21,742,946	E216K	probably benign	Het
Pskh1	G	A	8: 105,913,099	R137Q	possibly damaging	Het
Ptprb	T	G	10: 116,348,166	W1628G	probably benign	Het
Ranbp3	T	A	17: 56,707,955		probably null	Het
Rnf165	T	C	18: 77,563,181		probably benign	Het
Sart1	T	C	19: 5,383,795	D338G	probably damaging	Het
Scn8a	T	A	15: 100,972,822	Y251*	probably null	Het
Sdk2	G	T	11: 113,830,059	T1348K	probably benign	Het
Sec16a	A	G	2: 26,433,367	Y1272H	probably damaging	Het
Slc26a1	A	T	5: 108,672,037	L432Q	probably damaging	Het
Susd1	A	T	4: 59,412,203	F117I	possibly damaging	Het
Taf5	A	T	19: 47,076,110	Y465F	probably damaging	Het
Tcstv1	T	A	13: 119,894,094	M1L	probably benign	Het
Tectb	A	G	19: 55,189,626	D193G	possibly damaging	Het
Tirap	G	A	9: 35,189,169	P73L	probably damaging	Het
Tm6sf2	A	G	8: 70,075,389	D86G	possibly damaging	Het
Tmem161b	A	T	13: 84,294,858	H481L	probably damaging	Het
Tnrc6c	G	A	11: 117,759,708	V1763I	probably damaging	Het
Ubxn1	T	C	19: 8,872,220	S75P	probably benign	Het
Uhrf2	A	G	19: 30,089,302	K709E	probably damaging	Het
Vmn2r101	T	A	17: 19,588,830	Y74N	probably damaging	Het
Xirp2	A	G	2: 67,505,080	E81G	probably benign	Het
Zbtb45	A	G	7: 13,008,310	V7A	possibly damaging	Het
Zfp668	C	A	7: 127,866,302	R570L	possibly damaging	Het
Zmiz1	T	A	14: 25,635,966	M125K	possibly damaging	Het
Zmiz2	T	C	11: 6,405,072	L913P	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGAAACGGCATCCTTGTC -3'
(R):5'- TCAAGGAAGAGGCGTACTTTG -3'

Sequencing Primer
(F):5'- GAAACGGCATCCTTGTCAGGTTAC -3'
(R):5'- TACTTTGAGAGGTAGGGCAAGC -3'

Posted On

2017-02-10