Incidental Mutation 'R0556:Col24a1'
ID 45549
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 038748-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0556 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145020489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 287 (T287A)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect possibly damaging
Transcript: ENSMUST00000029848
AA Change: T287A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: T287A

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 15,164,213 (GRCm39) Y113* probably null Het
4930402F06Rik T C 2: 35,280,482 (GRCm39) probably benign Het
Acad11 A G 9: 103,992,501 (GRCm39) E481G probably damaging Het
Aldh1a1 A T 19: 20,611,842 (GRCm39) N389Y probably damaging Het
Bmpr2 C T 1: 59,854,487 (GRCm39) T112M probably damaging Het
Bms1 A G 6: 118,390,140 (GRCm39) Y227H probably damaging Het
Cab39 A G 1: 85,763,212 (GRCm39) probably benign Het
Ccn3 A T 15: 54,612,563 (GRCm39) T191S probably damaging Het
Ccno T C 13: 113,124,820 (GRCm39) probably null Het
Cct6b A G 11: 82,610,270 (GRCm39) probably benign Het
Cd101 A C 3: 100,927,970 (GRCm39) I37S probably damaging Het
Ces1a T C 8: 93,771,740 (GRCm39) H19R probably benign Het
Clec16a A G 16: 10,456,649 (GRCm39) probably null Het
Cntnap1 T C 11: 101,074,822 (GRCm39) F831S probably benign Het
Colgalt2 C T 1: 152,347,564 (GRCm39) probably benign Het
Cpd A G 11: 76,693,171 (GRCm39) probably benign Het
Cyp3a16 C A 5: 145,392,790 (GRCm39) M145I probably benign Het
Ddx54 T A 5: 120,757,719 (GRCm39) probably benign Het
Dock7 A T 4: 98,833,426 (GRCm39) L1925Q probably damaging Het
Eif4g1 A T 16: 20,494,544 (GRCm39) Y127F probably damaging Het
Erap1 T A 13: 74,808,444 (GRCm39) V52E probably damaging Het
Fbxo6 G T 4: 148,230,632 (GRCm39) T210N probably damaging Het
Fcgbpl1 C T 7: 27,858,803 (GRCm39) H2308Y probably benign Het
Garre1 T C 7: 33,939,222 (GRCm39) T222A probably damaging Het
Gnat3 T G 5: 18,224,596 (GRCm39) V332G probably damaging Het
Ift22 T A 5: 136,940,145 (GRCm39) probably null Het
Igkv4-71 A G 6: 69,220,171 (GRCm39) C109R probably damaging Het
Igsf10 A G 3: 59,236,296 (GRCm39) L1295P probably benign Het
Itga4 T C 2: 79,155,983 (GRCm39) I983T probably benign Het
Lhcgr A T 17: 89,079,491 (GRCm39) V65D probably damaging Het
Mau2 G C 8: 70,495,082 (GRCm39) T85R probably damaging Het
Morc2a T C 11: 3,631,809 (GRCm39) probably null Het
Morc2b A T 17: 33,356,812 (GRCm39) M320K probably benign Het
Ms4a18 C A 19: 10,991,065 (GRCm39) V10F probably damaging Het
Mstn A T 1: 53,103,284 (GRCm39) I207F probably benign Het
Mtor A G 4: 148,553,837 (GRCm39) E812G possibly damaging Het
Myo1h A G 5: 114,457,852 (GRCm39) Y121C probably damaging Het
Or11g27 T C 14: 50,771,381 (GRCm39) S171P probably benign Het
Or4a66 A C 2: 88,531,115 (GRCm39) V186G possibly damaging Het
Or8b53 A T 9: 38,667,041 (GRCm39) D19V possibly damaging Het
Plcd3 G A 11: 102,968,632 (GRCm39) T353M probably damaging Het
Pnpla7 T A 2: 24,942,313 (GRCm39) probably null Het
Ppp1r12b T A 1: 134,705,060 (GRCm39) Y876F probably damaging Het
Prelid2 T A 18: 42,084,245 (GRCm39) probably benign Het
Prickle1 A G 15: 93,398,662 (GRCm39) L722P probably benign Het
Prr12 A G 7: 44,680,093 (GRCm39) L1887P unknown Het
Ptk2b A G 14: 66,409,593 (GRCm39) L481P probably damaging Het
Rgl3 T A 9: 21,887,140 (GRCm39) K531* probably null Het
Sacs A G 14: 61,421,407 (GRCm39) I115V probably damaging Het
Septin3 G T 15: 82,167,966 (GRCm39) probably benign Het
Simc1 T C 13: 54,673,160 (GRCm39) S503P probably benign Het
Stard9 T C 2: 120,529,404 (GRCm39) V1887A probably benign Het
Synj2 T A 17: 6,088,230 (GRCm39) L1427* probably null Het
Taar2 A G 10: 23,816,793 (GRCm39) D111G probably damaging Het
Tlr5 A G 1: 182,801,716 (GRCm39) N340S probably damaging Het
Tmco2 A G 4: 120,966,314 (GRCm39) L14P probably damaging Het
Tnik A T 3: 28,679,367 (GRCm39) D746V possibly damaging Het
Trip11 C A 12: 101,850,777 (GRCm39) E811* probably null Het
Ttll9 T C 2: 152,815,526 (GRCm39) probably null Het
Uchl1 A G 5: 66,839,824 (GRCm39) E122G probably benign Het
Vwa3b C A 1: 37,203,566 (GRCm39) probably benign Het
Zan T C 5: 137,452,482 (GRCm39) N1533S unknown Het
Zfp687 G T 3: 94,917,719 (GRCm39) D684E probably damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGAGTATTGCAGACACCTGAAAC -3'
(R):5'- TGTTGTCGAATCCAGCGAAGAGAG -3'

Sequencing Primer
(F):5'- TGAAACAGCAGTGCCTCAG -3'
(R):5'- CATTCTTGCCTCACTAGGGAG -3'
Posted On 2013-06-11