Incidental Mutation 'R5875:Cmya5'
ID 455491
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E16Rik, 2310076E21Rik
MMRRC Submission 044082-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R5875 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 93177221-93281232 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93231692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1132 (V1132A)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: V1132A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: V1132A

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,028,737 (GRCm39) V154A possibly damaging Het
Abcc1 A G 16: 14,284,901 (GRCm39) E1250G possibly damaging Het
Ajap1 A C 4: 153,516,798 (GRCm39) I181R probably damaging Het
Akap9 A G 5: 4,127,285 (GRCm39) Y3711C probably benign Het
Ark2c T C 18: 77,650,877 (GRCm39) probably benign Het
Arl1 T C 10: 88,577,841 (GRCm39) S137P probably benign Het
Atp6v0a2 G A 5: 124,793,391 (GRCm39) V583I probably benign Het
Cdca7 T A 2: 72,313,901 (GRCm39) M230K probably benign Het
Chd9 A T 8: 91,778,464 (GRCm39) D2841V probably damaging Het
Chp1 T A 2: 119,402,296 (GRCm39) F90Y probably damaging Het
Ckap5 A G 2: 91,391,206 (GRCm39) T345A probably benign Het
Clca4b A C 3: 144,628,650 (GRCm39) S352R probably benign Het
Crb2 T A 2: 37,677,266 (GRCm39) probably null Het
Crhbp A G 13: 95,580,304 (GRCm39) F99L probably benign Het
Dnmt3l A T 10: 77,889,772 (GRCm39) M210L probably benign Het
Dyrk2 T A 10: 118,696,602 (GRCm39) R219W probably damaging Het
Exosc1 A G 19: 41,916,542 (GRCm39) I78T probably damaging Het
Exosc9 T C 3: 36,615,342 (GRCm39) probably null Het
Frmd5 A G 2: 121,388,959 (GRCm39) probably benign Het
Gata2 T C 6: 88,179,473 (GRCm39) L315P probably damaging Het
Gm17067 G A 7: 42,357,470 (GRCm39) T344I probably benign Het
Gm4884 A T 7: 40,692,360 (GRCm39) T110S possibly damaging Het
Hapln3 T C 7: 78,771,721 (GRCm39) E56G probably benign Het
Helq A C 5: 100,944,336 (GRCm39) I258S probably damaging Het
Hoxd10 T C 2: 74,522,426 (GRCm39) Y35H possibly damaging Het
Inpp5b T C 4: 124,674,199 (GRCm39) V302A possibly damaging Het
Inpp5d T A 1: 87,645,696 (GRCm39) I1027N possibly damaging Het
Ints2 T C 11: 86,129,138 (GRCm39) S482G probably benign Het
Itih1 C T 14: 30,651,487 (GRCm39) V902I probably benign Het
Jkampl T C 6: 73,446,028 (GRCm39) I174V possibly damaging Het
Kctd16 T A 18: 40,390,447 (GRCm39) probably benign Het
Kif27 T C 13: 58,458,918 (GRCm39) N971S probably benign Het
Klra17 T C 6: 129,851,791 (GRCm39) D27G probably benign Het
Leo1 G C 9: 75,357,842 (GRCm39) R412S probably damaging Het
Lonrf2 T C 1: 38,846,128 (GRCm39) N348S probably benign Het
Lpp G A 16: 24,427,059 (GRCm39) G62E probably benign Het
Lyn G A 4: 3,745,631 (GRCm39) probably null Het
Macf1 T A 4: 123,326,107 (GRCm39) N5128I possibly damaging Het
Mapk7 T A 11: 61,384,524 (GRCm39) I61L probably benign Het
Mindy1 T C 3: 95,202,125 (GRCm39) V334A probably damaging Het
Muc20 G A 16: 32,614,189 (GRCm39) T396I possibly damaging Het
Myo5b A T 18: 74,840,973 (GRCm39) probably null Het
Noc4l A C 5: 110,799,176 (GRCm39) probably null Het
Oas1c A G 5: 120,943,627 (GRCm39) Y171H probably damaging Het
Pclo A T 5: 14,730,614 (GRCm39) probably benign Het
Pmpcb G A 5: 21,947,944 (GRCm39) E216K probably benign Het
Pskh1 G A 8: 106,639,731 (GRCm39) R137Q possibly damaging Het
Ptprb T G 10: 116,184,071 (GRCm39) W1628G probably benign Het
Ranbp3 T A 17: 57,014,955 (GRCm39) probably null Het
Sart1 T C 19: 5,433,823 (GRCm39) D338G probably damaging Het
Scn8a T A 15: 100,870,703 (GRCm39) Y251* probably null Het
Sdk2 G T 11: 113,720,885 (GRCm39) T1348K probably benign Het
Sec16a A G 2: 26,323,379 (GRCm39) Y1272H probably damaging Het
Slc26a1 A T 5: 108,819,903 (GRCm39) L432Q probably damaging Het
Susd1 A T 4: 59,412,203 (GRCm39) F117I possibly damaging Het
Taf5 A T 19: 47,064,549 (GRCm39) Y465F probably damaging Het
Tcstv1a T A 13: 120,355,630 (GRCm39) M1L probably benign Het
Tectb A G 19: 55,178,058 (GRCm39) D193G possibly damaging Het
Tex56 T G 13: 35,116,429 (GRCm39) C59W probably damaging Het
Tirap G A 9: 35,100,465 (GRCm39) P73L probably damaging Het
Tm6sf2 A G 8: 70,528,039 (GRCm39) D86G possibly damaging Het
Tmem161b A T 13: 84,442,977 (GRCm39) H481L probably damaging Het
Tnrc6c G A 11: 117,650,534 (GRCm39) V1763I probably damaging Het
Ubxn1 T C 19: 8,849,584 (GRCm39) S75P probably benign Het
Uhrf2 A G 19: 30,066,702 (GRCm39) K709E probably damaging Het
Vmn2r101 T A 17: 19,809,092 (GRCm39) Y74N probably damaging Het
Xirp2 A G 2: 67,335,424 (GRCm39) E81G probably benign Het
Zbtb45 A G 7: 12,742,237 (GRCm39) V7A possibly damaging Het
Zfp668 C A 7: 127,465,474 (GRCm39) R570L possibly damaging Het
Zmiz1 T A 14: 25,636,390 (GRCm39) M125K possibly damaging Het
Zmiz2 T C 11: 6,355,072 (GRCm39) L913P probably damaging Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93,229,628 (GRCm39) missense probably benign 0.13
IGL00516:Cmya5 APN 13 93,234,675 (GRCm39) missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93,230,669 (GRCm39) missense probably benign 0.00
IGL00948:Cmya5 APN 13 93,227,544 (GRCm39) missense probably benign
IGL00966:Cmya5 APN 13 93,234,414 (GRCm39) missense probably benign 0.33
IGL00988:Cmya5 APN 13 93,234,441 (GRCm39) missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93,221,120 (GRCm39) missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93,233,454 (GRCm39) missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93,225,714 (GRCm39) missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93,230,535 (GRCm39) missense probably benign
IGL01679:Cmya5 APN 13 93,201,828 (GRCm39) missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93,225,807 (GRCm39) missense probably benign 0.00
IGL01861:Cmya5 APN 13 93,226,256 (GRCm39) missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93,231,057 (GRCm39) missense probably benign 0.00
IGL02034:Cmya5 APN 13 93,221,043 (GRCm39) splice site probably benign
IGL02103:Cmya5 APN 13 93,228,635 (GRCm39) missense probably benign 0.05
IGL02174:Cmya5 APN 13 93,185,415 (GRCm39) missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93,226,658 (GRCm39) missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93,229,242 (GRCm39) missense probably benign 0.14
IGL02229:Cmya5 APN 13 93,229,194 (GRCm39) missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93,234,527 (GRCm39) missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93,227,163 (GRCm39) missense probably benign 0.40
IGL02409:Cmya5 APN 13 93,226,706 (GRCm39) missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93,228,366 (GRCm39) missense probably benign 0.00
IGL02676:Cmya5 APN 13 93,229,361 (GRCm39) missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02685:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02686:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02724:Cmya5 APN 13 93,233,163 (GRCm39) missense probably benign
IGL02727:Cmya5 APN 13 93,234,753 (GRCm39) missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93,229,065 (GRCm39) missense probably benign 0.41
IGL03079:Cmya5 APN 13 93,234,209 (GRCm39) missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93,227,376 (GRCm39) missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93,227,778 (GRCm39) nonsense probably null
IGL03336:Cmya5 APN 13 93,230,013 (GRCm39) missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93,201,850 (GRCm39) missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93,225,854 (GRCm39) missense probably benign 0.22
P4748:Cmya5 UTSW 13 93,210,983 (GRCm39) splice site probably benign
R0123:Cmya5 UTSW 13 93,232,412 (GRCm39) missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0331:Cmya5 UTSW 13 93,280,911 (GRCm39) missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93,231,377 (GRCm39) missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93,229,256 (GRCm39) missense probably benign 0.06
R0416:Cmya5 UTSW 13 93,226,364 (GRCm39) missense probably benign 0.05
R0446:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R0457:Cmya5 UTSW 13 93,232,095 (GRCm39) missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93,226,505 (GRCm39) missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93,229,299 (GRCm39) missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93,230,357 (GRCm39) nonsense probably null
R0698:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93,230,954 (GRCm39) missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93,231,620 (GRCm39) missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93,178,043 (GRCm39) missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93,178,033 (GRCm39) missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93,228,566 (GRCm39) missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93,201,835 (GRCm39) missense probably benign 0.44
R1572:Cmya5 UTSW 13 93,230,777 (GRCm39) missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93,200,027 (GRCm39) missense probably benign 0.27
R1735:Cmya5 UTSW 13 93,226,297 (GRCm39) missense probably benign 0.11
R1743:Cmya5 UTSW 13 93,233,825 (GRCm39) missense probably benign 0.33
R1750:Cmya5 UTSW 13 93,232,171 (GRCm39) missense probably benign
R1827:Cmya5 UTSW 13 93,210,956 (GRCm39) missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93,227,032 (GRCm39) missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93,229,320 (GRCm39) missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93,205,891 (GRCm39) missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93,230,003 (GRCm39) missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93,230,210 (GRCm39) missense probably benign 0.15
R2497:Cmya5 UTSW 13 93,234,513 (GRCm39) missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93,230,066 (GRCm39) missense probably benign 0.41
R2917:Cmya5 UTSW 13 93,227,572 (GRCm39) nonsense probably null
R2944:Cmya5 UTSW 13 93,229,350 (GRCm39) nonsense probably null
R3039:Cmya5 UTSW 13 93,228,758 (GRCm39) missense probably benign 0.12
R3078:Cmya5 UTSW 13 93,185,435 (GRCm39) missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93,231,874 (GRCm39) nonsense probably null
R3717:Cmya5 UTSW 13 93,228,995 (GRCm39) missense probably benign 0.12
R3768:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93,227,727 (GRCm39) missense probably benign 0.07
R3888:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R3897:Cmya5 UTSW 13 93,233,189 (GRCm39) missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93,225,707 (GRCm39) missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93,228,464 (GRCm39) missense probably benign 0.36
R4471:Cmya5 UTSW 13 93,228,833 (GRCm39) missense probably benign 0.01
R4493:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4495:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4544:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4545:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4624:Cmya5 UTSW 13 93,200,059 (GRCm39) missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93,230,082 (GRCm39) missense probably benign 0.04
R4965:Cmya5 UTSW 13 93,232,295 (GRCm39) missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93,227,093 (GRCm39) missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93,228,111 (GRCm39) missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93,229,880 (GRCm39) missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93,232,569 (GRCm39) missense probably benign 0.00
R5220:Cmya5 UTSW 13 93,228,804 (GRCm39) missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93,232,703 (GRCm39) missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93,219,781 (GRCm39) missense probably benign 0.28
R5356:Cmya5 UTSW 13 93,199,993 (GRCm39) missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93,228,476 (GRCm39) missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93,231,707 (GRCm39) missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93,229,271 (GRCm39) missense probably benign 0.15
R5628:Cmya5 UTSW 13 93,226,218 (GRCm39) missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93,182,457 (GRCm39) missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93,234,684 (GRCm39) missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93,182,374 (GRCm39) critical splice donor site probably null
R5806:Cmya5 UTSW 13 93,230,445 (GRCm39) missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93,229,288 (GRCm39) missense probably benign 0.04
R5872:Cmya5 UTSW 13 93,233,943 (GRCm39) missense probably benign 0.01
R5896:Cmya5 UTSW 13 93,182,373 (GRCm39) critical splice donor site probably null
R5910:Cmya5 UTSW 13 93,229,151 (GRCm39) missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93,226,052 (GRCm39) missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93,226,157 (GRCm39) missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93,281,021 (GRCm39) unclassified probably benign
R6102:Cmya5 UTSW 13 93,230,739 (GRCm39) missense probably benign
R6117:Cmya5 UTSW 13 93,231,674 (GRCm39) missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93,233,784 (GRCm39) missense possibly damaging 0.73
R6188:Cmya5 UTSW 13 93,229,952 (GRCm39) missense possibly damaging 0.61
R6219:Cmya5 UTSW 13 93,230,951 (GRCm39) missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93,229,814 (GRCm39) missense probably benign 0.41
R6346:Cmya5 UTSW 13 93,228,698 (GRCm39) missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93,210,972 (GRCm39) missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93,225,723 (GRCm39) missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93,226,316 (GRCm39) missense probably benign 0.05
R6649:Cmya5 UTSW 13 93,234,533 (GRCm39) missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93,229,547 (GRCm39) missense probably damaging 0.99
R6652:Cmya5 UTSW 13 93,229,403 (GRCm39) missense probably benign 0.04
R6669:Cmya5 UTSW 13 93,229,767 (GRCm39) missense probably benign 0.03
R6881:Cmya5 UTSW 13 93,226,800 (GRCm39) missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93,227,760 (GRCm39) missense probably benign 0.04
R6933:Cmya5 UTSW 13 93,231,644 (GRCm39) missense probably benign 0.03
R7021:Cmya5 UTSW 13 93,230,063 (GRCm39) missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93,205,786 (GRCm39) critical splice donor site probably null
R7068:Cmya5 UTSW 13 93,229,205 (GRCm39) missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93,227,483 (GRCm39) missense probably benign 0.00
R7088:Cmya5 UTSW 13 93,228,372 (GRCm39) missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93,226,448 (GRCm39) missense probably benign 0.41
R7177:Cmya5 UTSW 13 93,231,836 (GRCm39) missense probably benign 0.00
R7188:Cmya5 UTSW 13 93,182,546 (GRCm39) missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93,226,938 (GRCm39) missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93,232,208 (GRCm39) missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93,229,305 (GRCm39) missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93,229,061 (GRCm39) missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93,228,169 (GRCm39) missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93,205,831 (GRCm39) missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93,228,346 (GRCm39) missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93,233,942 (GRCm39) missense probably benign 0.02
R7552:Cmya5 UTSW 13 93,205,820 (GRCm39) missense probably benign 0.41
R7624:Cmya5 UTSW 13 93,226,865 (GRCm39) missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93,219,720 (GRCm39) missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93,230,629 (GRCm39) missense probably benign 0.13
R7753:Cmya5 UTSW 13 93,234,680 (GRCm39) missense probably benign 0.18
R7757:Cmya5 UTSW 13 93,234,780 (GRCm39) missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93,230,770 (GRCm39) missense probably benign 0.00
R7825:Cmya5 UTSW 13 93,234,136 (GRCm39) missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93,226,265 (GRCm39) missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93,232,865 (GRCm39) missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93,233,512 (GRCm39) small deletion probably benign
R8127:Cmya5 UTSW 13 93,231,122 (GRCm39) missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93,229,986 (GRCm39) missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93,228,142 (GRCm39) nonsense probably null
R8446:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93,230,304 (GRCm39) missense probably benign 0.00
R8686:Cmya5 UTSW 13 93,231,888 (GRCm39) missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93,226,229 (GRCm39) missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93,225,888 (GRCm39) missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93,177,991 (GRCm39) missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93,200,048 (GRCm39) missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93,232,840 (GRCm39) missense probably benign 0.01
R8985:Cmya5 UTSW 13 93,233,664 (GRCm39) missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93,228,572 (GRCm39) missense probably benign 0.03
R9087:Cmya5 UTSW 13 93,233,711 (GRCm39) missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93,234,108 (GRCm39) missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93,233,878 (GRCm39) missense unknown
R9209:Cmya5 UTSW 13 93,226,866 (GRCm39) missense probably benign 0.45
R9222:Cmya5 UTSW 13 93,230,579 (GRCm39) missense probably benign 0.00
R9229:Cmya5 UTSW 13 93,232,176 (GRCm39) missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93,229,884 (GRCm39) missense probably benign
R9385:Cmya5 UTSW 13 93,230,880 (GRCm39) missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93,226,209 (GRCm39) missense probably benign 0.22
R9452:Cmya5 UTSW 13 93,232,394 (GRCm39) missense probably benign
R9492:Cmya5 UTSW 13 93,177,822 (GRCm39) makesense probably null
R9600:Cmya5 UTSW 13 93,226,604 (GRCm39) missense probably damaging 1.00
R9712:Cmya5 UTSW 13 93,201,881 (GRCm39) critical splice acceptor site probably null
R9742:Cmya5 UTSW 13 93,231,935 (GRCm39) missense possibly damaging 0.89
RF020:Cmya5 UTSW 13 93,205,799 (GRCm39) missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93,233,195 (GRCm39) missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1176:Cmya5 UTSW 13 93,233,298 (GRCm39) missense unknown
Z1176:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1177:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTAGCAGGCTCAGATCTTC -3'
(R):5'- CCTGATTCTGCATTTGCGTCAG -3'

Sequencing Primer
(F):5'- GGCTCAGATCTTCGAACACAGG -3'
(R):5'- GATTCTGCATTTGCGTCAGAATTC -3'
Posted On 2017-02-10