Incidental Mutation 'R5875:Lpp'
ID455498
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene NameLIM domain containing preferred translocation partner in lipoma
SynonymsB130055L10Rik, 9430020K16Rik
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location24393507-24992578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24608309 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 62 (G62E)
Ref Sequence ENSEMBL: ENSMUSP00000078005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988]
Predicted Effect probably benign
Transcript: ENSMUST00000038053
AA Change: G62E

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: G62E

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078988
AA Change: G62E

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: G62E

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231352
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24845188 missense probably damaging 1.00
IGL01354:Lpp APN 16 24762066 nonsense probably null
IGL02141:Lpp APN 16 24761615 missense probably damaging 0.98
IGL02182:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02230:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02232:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02234:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02236:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02371:Lpp APN 16 24761611 missense probably damaging 0.96
IGL03265:Lpp APN 16 24761987 missense probably damaging 1.00
PIT4585001:Lpp UTSW 16 24761947 missense probably benign 0.23
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0092:Lpp UTSW 16 24761602 missense probably benign 0.01
R0385:Lpp UTSW 16 24761837 missense probably damaging 1.00
R0389:Lpp UTSW 16 24608241 missense probably damaging 1.00
R0504:Lpp UTSW 16 24971970 missense probably damaging 1.00
R0798:Lpp UTSW 16 24971872 nonsense probably null
R1199:Lpp UTSW 16 24681860 missense probably damaging 1.00
R1581:Lpp UTSW 16 24681841 nonsense probably null
R1755:Lpp UTSW 16 24845124 missense probably benign
R1848:Lpp UTSW 16 24761655 missense probably damaging 1.00
R1980:Lpp UTSW 16 24661701 missense probably damaging 1.00
R3432:Lpp UTSW 16 24889886 missense probably benign 0.04
R3755:Lpp UTSW 16 24845161 missense probably benign 0.00
R4078:Lpp UTSW 16 24681861 missense probably damaging 1.00
R4214:Lpp UTSW 16 24762054 nonsense probably null
R4712:Lpp UTSW 16 24761657 missense possibly damaging 0.94
R4806:Lpp UTSW 16 24661680 missense probably damaging 0.97
R4968:Lpp UTSW 16 24979314 missense probably damaging 1.00
R5047:Lpp UTSW 16 24971846 missense probably damaging 1.00
R5371:Lpp UTSW 16 24889804 missense probably damaging 1.00
R5536:Lpp UTSW 16 24845206 missense possibly damaging 0.54
R7285:Lpp UTSW 16 24977279 missense probably damaging 1.00
R7846:Lpp UTSW 16 24608126 start codon destroyed probably null 0.98
R7929:Lpp UTSW 16 24608126 start codon destroyed probably null 0.98
Z1176:Lpp UTSW 16 24761603 missense probably benign 0.00
Z1177:Lpp UTSW 16 24661712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGATTTCCACAATGTCTC -3'
(R):5'- ACTTTACGAACCCAACTCTGTG -3'

Sequencing Primer
(F):5'- ACAATGTCTCACCCATCTTGG -3'
(R):5'- GAACCCAACTCTGTGAGATTTAAC -3'
Posted On2017-02-10