Incidental Mutation 'R5875:Muc20'
ID455499
Institutional Source Beutler Lab
Gene Symbol Muc20
Ensembl Gene ENSMUSG00000035638
Gene Namemucin 20
Synonyms
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32777419-32797435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32793819 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 396 (T396I)
Ref Sequence ENSEMBL: ENSMUSP00000041221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041123
AA Change: T396I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: T396I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 3.3e-8 PROSPERO
internal_repeat_1 138 170 3.3e-8 PROSPERO
internal_repeat_2 144 161 5.26e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 5.26e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115116
AA Change: T396I

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: T396I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 2.16e-8 PROSPERO
internal_repeat_1 138 170 2.16e-8 PROSPERO
internal_repeat_2 144 161 4e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 4e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sdk2 G T 11: 113,830,059 T1348K probably benign Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Muc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Muc20 APN 16 32793703 missense probably benign 0.10
IGL02016:Muc20 APN 16 32797352 missense possibly damaging 0.46
IGL02092:Muc20 APN 16 32794272 missense probably damaging 0.99
IGL02415:Muc20 APN 16 32794681 missense unknown
R6669_muc20_072 UTSW 16 32793937 missense possibly damaging 0.94
R0552:Muc20 UTSW 16 32793930 missense probably damaging 0.98
R0629:Muc20 UTSW 16 32793421 missense possibly damaging 0.66
R0669:Muc20 UTSW 16 32794480 missense unknown
R0725:Muc20 UTSW 16 32793488 missense probably benign 0.05
R1676:Muc20 UTSW 16 32794279 missense probably damaging 1.00
R1771:Muc20 UTSW 16 32793852 missense probably damaging 0.97
R1778:Muc20 UTSW 16 32794141 missense possibly damaging 0.49
R1967:Muc20 UTSW 16 32794242 missense probably benign 0.03
R2104:Muc20 UTSW 16 32794177 missense probably damaging 0.99
R3054:Muc20 UTSW 16 32779029 missense probably benign 0.18
R4704:Muc20 UTSW 16 32779074 missense possibly damaging 0.70
R4893:Muc20 UTSW 16 32794672 missense possibly damaging 0.66
R4986:Muc20 UTSW 16 32777635 intron probably benign
R5191:Muc20 UTSW 16 32794476 missense unknown
R5195:Muc20 UTSW 16 32794476 missense unknown
R5931:Muc20 UTSW 16 32794574 missense possibly damaging 0.81
R6434:Muc20 UTSW 16 32794806 missense probably benign 0.01
R6523:Muc20 UTSW 16 32793450 missense possibly damaging 0.90
R6580:Muc20 UTSW 16 32793489 missense possibly damaging 0.77
R6669:Muc20 UTSW 16 32793937 missense possibly damaging 0.94
R7028:Muc20 UTSW 16 32794246 missense probably benign 0.03
R7681:Muc20 UTSW 16 32793619 missense probably benign 0.34
R7722:Muc20 UTSW 16 32797386 missense probably benign 0.00
R8678:Muc20 UTSW 16 32797419 start gained probably benign
R8730:Muc20 UTSW 16 32779116 missense probably benign 0.03
R8838:Muc20 UTSW 16 32793459 missense possibly damaging 0.64
W0251:Muc20 UTSW 16 32793853 missense possibly damaging 0.91
X0011:Muc20 UTSW 16 32793252 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GTTCCAACAGAGGTAAGAGTCTG -3'
(R):5'- AGCAGCTCTTCCTCTGACAG -3'

Sequencing Primer
(F):5'- TAAGAGTCTGGGCCACTGCTG -3'
(R):5'- AGTTCAGCTGGGGTCCTCAG -3'
Posted On2017-02-10