Incidental Mutation 'R0556:Dock7'
ID45550
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission 038748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0556 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98945189 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1925 (L1925Q)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650] [ENSMUST00000205652]
Predicted Effect probably damaging
Transcript: ENSMUST00000030286
AA Change: L1955Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: L1955Q

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: L1927Q
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: L1927Q

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124040
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: L1957Q
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: L1957Q

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205484
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: L1925Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206128
Meta Mutation Damage Score 0.9584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,943,951 Y113* probably null Het
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Bms1 A G 6: 118,413,179 Y227H probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Clec16a A G 16: 10,638,785 probably null Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Ddx54 T A 5: 120,619,654 probably benign Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Ppp1r12b T A 1: 134,777,322 Y876F probably damaging Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
BB005:Dock7 UTSW 4 99001098 missense
BB015:Dock7 UTSW 4 99001098 missense
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
R7928:Dock7 UTSW 4 99001098 missense
R7984:Dock7 UTSW 4 98989066 missense unknown
R8287:Dock7 UTSW 4 98977920 missense unknown
R8439:Dock7 UTSW 4 99083029 missense
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGTTGCAAATGCCAATTCCTGAG -3'
(R):5'- GTGGAGCCCTTCTTTGACACCTATG -3'

Sequencing Primer
(F):5'- TGCCTAAAAACTGCCTAGTGAG -3'
(R):5'- CTTTGACACCTATGAGATGAAGGAC -3'
Posted On2013-06-11